Defective interfering influenza virus confers only short-lived protection against influenza virus disease: Evidence for a role for adaptive immunity in DI virus-mediated protection in vivo

Abstract

We have shown earlier that a single dose of cloned defective interfering (DI) influenza A virus strongly protects mice from disease following a lethal challenge with different subtypes of influenza A virus. These animals suffered no clinical disease but experienced a subclinical infection which rendered them immune to reinfection with the same challenge virus. However, little is known about how DI virus achieves such protection. Here we investigated the role of adaptive immunity in DI virus-mediated protection using severe-combined immunodeficient (SCID) mice, which lack competence in both B- and T-cell compartments but retain NK cell activity. SCID mice which were treated with DI virus and infected with influenza virus initially remained completely well, while infected litter mates that received UV-inactivated DI virus became seriously ill and died. However, after 10 days of good health, the DI virus-protected SCID mice developed a clinical disease that was similar, but not completely identical, to the acute influenza disease. Disease was delayed longer by a higher dose of DI virus. We excluded the possibilities that the DI virus load in the lungs had declined, that the DI RNA sequence had changed so that it no longer interfered with the infectious genome, or that infectious virus had become resistant to the DI virus. These data show that while DI virus provides full protection from the acute disease in the absence of adaptive immunity, that same immunity is essential for clearing the infection. This indicates that the conventional view that DI virus-induced protection is mediated solely by competition for replication with the challenge virus is incorrect for influenza virus.

Cloned Defective Interfering Influenza Virus Protects Ferrets from Pandemic 2009 Influenza A Virus and Allows Protective Immunity to Be Established

“…These data demonstrate for the first time in ferrets the ability of the 244 DI RNA to be amplified by the agent that it is acting against – in this case A/Cal influenza virus. This observation is fully consistent with data arising from the mouse model [23], [24].…”

“…RNA was extracted from nasal washes with QIAamp mini RNA kit (Qiagen) and quantitative real time PCR performed to quantitate virion-sense RNA using an ABI prism 7000 [24]. We used the primers and probe: 244 1F (5′ CTCTTTGCCCAGAATGAGGAAT 3′), 244 1R (5′ CATAATCAAGAAGTACACATCAGGAAGAC 3′) and probe (5′ FAM-CCCTCAGTCTTCTCC 3′).…”

“…244/PR8 is not toxic and generates no adverse clinical effects, and the administered preparation is not infectious. Different strains of mice and elderly mice are well protected [24]–[26]. Infection of mice with severe-combined immunodeficiency (SCID) shows that the adaptive immune response is not required for protection but is needed to clear infection [24].…”

“…Different strains of mice and elderly mice are well protected [24]–[26]. Infection of mice with severe-combined immunodeficiency (SCID) shows that the adaptive immune response is not required for protection but is needed to clear infection [24]. Interferon is made locally in the respiratory tract in response to DI virus but is not required for protection from influenza A viruses.…”

Biological Activities of 'Noninfectious' Influenza A Virus Particles

“…Nothing is known about the direct impact of DI particles on viral replication in vivo . DI particles limit virus-induced pathology and replication when cointroduced with normal virus into mice, but this may be through enhanced activation of the host innate immune response [43,45]. A study showed that the host cytosolic RNA sensor RIG-I preferentially binds DI RNAs rather than the longer, intact IAV gene segments [46].…”