Defect of Dpb2p, a noncatalytic subunit of DNA polymerase ɛ, promotes error prone replication of undamaged chromosomal DNA in Saccharomyces cerevisiae

Kraszewska, Joanna; Garbacz, Marta A.; Jonczyk, Piotr; Fijałkowska, Iwona J.; Jaszczur, Malgorzata

doi:10.1016/j.mrfmmm.2012.06.002

Cited by 25 publications

(40 citation statements)

References 63 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We confirmed an increased participation of Pol in DNA replication in the dpb2-100 mutant [50]. However, even in the absence of Pol activity (in rev3 strains) the presence of the dpb2-100 allele elevates the mutation rate, indicating that a significant part of mutagenesis is Pol -independent.…”

Section: Introductionsupporting

confidence: 71%

“…Then pMG29 bearing DPB2 under the heterologous promoter and terminator was replaced with a centromeric vector pMG30-000 or pMG30-100 (bearing, respectively, DPB2 or dpb2-100 under the control of DPB2 promoter and terminator) using plasmid shuffle technique, to give SC674 and SC675 yeast strains, respectively. Leu + Ura + transformants were selected and toothpicked twice onto 5-FOA plates at 23 • C. Strains for spontaneous mutation spectra analysis were I (−2) I-7B-YUNI300 derivatives [47,50]. Strains carrying the pol3-5DV allele were constructed by transformation of I (−2) I-7B-YUNI300 derivatives carrying the wild type DPB2 or dpb2-100 allele with a cassette (Eco52I-linearized pY19 plasmid, kindly provided by D. Gordenin) introducing the pol3-5DV mutation.…”

Section: Media and Strainsmentioning

confidence: 99%

“…The spontaneous-mutation frequency and rates in strains selected for the analysis of mutation spectra was determined as previously [33,50]. CAN1 locus was amplified by PCR using the DNA as a template and primers MG CANFF -5 AAGAGTGGTTGCGAACA-GAG3 and MG CANRR -5 GGAGCAAGATTGTTGTGGTG3 .…”

Section: Can1 Mutation Spectra Analysismentioning

confidence: 99%

“…a Relative rate is the rate in a given strain divided by the corresponding rate in the DPB2 RNH201 strain; 95% confidence intervals are shown in parentheses; p value was >0.05 for dpb2-100 RNH201 vs. dpb2-100 rnh201 , calculated using non-parametric Mann-Whitney-U test. [33,46,50,[69][70][71][72][73]. The overall rate of Can R mutations is 3.7-fold lower in the rev3 strain than in the wild-type (Table 5A).…”

Section: Characterization Of Can R Mutations In Dpb2-100 Strainsmentioning

confidence: 99%

See 3 more Smart Citations

Fidelity consequences of the impaired interaction between DNA polymerase epsilon and the GINS complex

et al. 2015

Self Cite

View full text Add to dashboard Cite

DNA polymerase epsilon interacts with the CMG (Cdc45-MCM-GINS) complex by Dpb2p, the non-catalytic subunit of DNA polymerase epsilon. It is postulated that CMG is responsible for targeting of Pol ɛ to the leading strand. We isolated a mutator dpb2-100 allele which encodes the mutant form of Dpb2p. We showed previously that Dpb2-100p has impaired interactions with Pol2p, the catalytic subunit of Pol ɛ. Here, we present that Dpb2-100p has strongly impaired interaction with the Psf1 and Psf3 subunits of the GINS complex. Our in vitro results suggest that while dpb2-100 does not alter Pol ɛ's biochemical properties including catalytic efficiency, processivity or proofreading activity - it moderately decreases the fidelity of DNA synthesis. As the in vitro results did not explain the strong in vivo mutator effect of the dpb2-100 allele we analyzed the mutation spectrum in vivo. The analysis of the mutation rates in the dpb2-100 mutant indicated an increased participation of the error-prone DNA polymerase zeta in replication. However, even in the absence of Pol ζ activity the presence of the dpb2-100 allele was mutagenic, indicating that a significant part of mutagenesis is Pol ζ-independent. A strong synergistic mutator effect observed for transversions in the triple mutant dpb2-100 pol2-4 rev3Δ as compared to pol2-4 rev3Δ and dpb2-100 rev3Δ suggests that in the presence of the dpb2-100 allele the number of replication errors is enhanced. We hypothesize that in the dpb2-100 strain, where the interaction between Pol ɛ and GINS is weakened, the access of Pol δ to the leading strand may be increased. The increased participation of Pol δ on the leading strand in the dpb2-100 mutant may explain the synergistic mutator effect observed in the dpb2-100 pol3-5DV double mutant.

show abstract

Section: Introductionsupporting

confidence: 71%

Section: Media and Strainsmentioning

confidence: 99%

Section: Can1 Mutation Spectra Analysismentioning

confidence: 99%

Section: Characterization Of Can R Mutations In Dpb2-100 Strainsmentioning

confidence: 99%

See 2 more Smart Citations

Fidelity consequences of the impaired interaction between DNA polymerase epsilon and the GINS complex

et al. 2015

Self Cite

View full text Add to dashboard Cite

show abstract

“…One potential drawback to a stable connection between Pol e and CMG is the need for dynamic exchange between high-fidelity and lowfidelity polymerases to overcome template blocks during fork progression (41). Temperature-sensitive mutants of the Dpb2 subunit of Pol e that no longer bind stably to the Pol2 catalytic subunit confer a strong mutator phenotype that is partially dependent on Pol ζ, suggesting that low-fidelity polymerases have greater access to the leading strand when the CMG-Dpb2-Pol2 connection is disrupted (34,42,43). Together, these data suggest a model whereby the Pol e-CMG connection is flexible, enabling translesion and other polymerases to bind the DNA temporarily without displacing Pol e from the replisome.…”

Section: Discussionmentioning

confidence: 99%

CMG helicase and DNA polymerase ε form a functional 15-subunit holoenzyme for eukaryotic leading-strand DNA replication

Langston

Zhang

Yurieva

et al. 2014

Proc. Natl. Acad. Sci. U.S.A.

144

161

View full text Add to dashboard Cite

DNA replication in eukaryotes is asymmetric, with separate DNA polymerases (Pol) dedicated to bulk synthesis of the leading and lagging strands. Pol α/primase initiates primers on both strands that are extended by Pol e on the leading strand and by Pol δ on the lagging strand. The CMG (Cdc45-MCM-GINS) helicase surrounds the leading strand and is proposed to recruit Pol e for leading-strand synthesis, but to date a direct interaction between CMG and Pol e has not been demonstrated. While purifying CMG helicase overexpressed in yeast, we detected a functional complex between CMG and native Pol e. Using pure CMG and Pol e, we reconstituted a stable 15-subunit CMG-Pol e complex and showed that it is a functional polymerase-helicase on a model replication fork in vitro. On its own, the Pol2 catalytic subunit of Pol e is inefficient in CMG-dependent replication, but addition of the Dpb2 protein subunit of Pol e, known to bind the Psf1 protein subunit of CMG, allows stable synthesis with CMG. Dpb2 does not affect Pol δ function with CMG, and thus we propose that the connection between Dpb2 and CMG helps to stabilize Pol e on the leading strand as part of a 15-subunit leading-strand holoenzyme we refer to as CMGE. Direct binding between Pol e and CMG provides an explanation for specific targeting of Pol e to the leading strand and provides clear mechanistic evidence for how strand asymmetry is maintained in eukaryotes.DNA replication | replication fork | helicase | polymerase | CMG

show abstract

Mitotic Genome Variations in Yeast and Other Fungi

Skoneczna

Skoneczny

2017

Somatic Genome Variation in Animals, Plants, and Microorganisms

View full text Add to dashboard Cite

Defect of Dpb2p, a noncatalytic subunit of DNA polymerase ɛ, promotes error prone replication of undamaged chromosomal DNA in Saccharomyces cerevisiae

Cited by 25 publications

References 63 publications

Fidelity consequences of the impaired interaction between DNA polymerase epsilon and the GINS complex

Fidelity consequences of the impaired interaction between DNA polymerase epsilon and the GINS complex

CMG helicase and DNA polymerase ε form a functional 15-subunit holoenzyme for eukaryotic leading-strand DNA replication

Mitotic Genome Variations in Yeast and Other Fungi

Contact Info

Product

Resources

About