Decreased expression of hsa_circ_0003570 in hepatocellular carcinoma and its clinical significance

Fu, Liyun; Wu, Shengping; Yao, Ting; Chen, Qingqing; Xie, Youhua; Sheng, Ying; Chen, Zhigang; Xiao, Bingxiu; Hu, Yaoren

doi:10.1002/jcla.22239

Cited by 66 publications

(49 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This may be due to the complex tumor microenvironment and the relatively small sample size examined. Currently, a series of circRNAs, e.g., hsa_circ_0005075, hsa_circ_0004018, and hsa_circ_0003570, have been demonstrated to influence the development and prognosis of HCC [33][34][35]. However, conclusive or practical criteria for the prognosis of HCC still require further investigation.…”

Section: Discussionmentioning

confidence: 39%

Circular RNA Hsa_Circ_0091579 Serves as a Diagnostic and Prognostic Marker for Hepatocellular Carcinoma

Zhang

Lin

2018

Cell Physiol Biochem

View full text Add to dashboard Cite

Background/Aims: An increasing number of studies have suggested that circular RNAs (circRNAs) have vital roles in carcinogenesis and tumor progression. However, the function of circRNAs in hepatocellular carcinoma (HCC) remains poorly characterized. Methods: We investigated the levels of circRNAs in patients with HCC to identify potential diagnostic biomarkers. We examined circRNA expression profiles in liver tumors and paired non-cancerous liver tissues from three HCC patients with cancer thrombus using a circRNA microarray. Bioinformatics analysis was performed to find circRNAs with significantly altered expression levels between tumors and their paired non-tumor tissues. We confirmed our initial findings by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Receiver operating characteristic (ROC) curves were also applied to identify a candidate circRNA with the optimal specificity and sensitivity. Finally, X-tile software was adopted to calculate the most efficient cut-off value for hsa_circ_0091579 expression. Results: Microarray analysis identified 20 unique circRNAs that were differentially expressed between tumor and non-tumor tissues (P < 0.05). The expression of these 20 circRNAs was verified by qRT-PCR. The expression of hsa_circ_16245-1 and hsa_circ_0091579 mRNA was consistent with their levels as tested by the microarray. The ROC curves showed that both hsa_circ_16245-1 and hsa_circ_0091579 had favorable specificity and sensitivity. We further confirmed that hsa_circ_0091579 was significantly upregulated in HCC and its high expression was intimately associated with a worse overall survival in patients with HCC. Conclusion: Hsa_circ_0091579 may play a critical role in HCC progression and serve as a potential biomarker for the prognosis of patients with HCC.

show abstract

Section: Discussionmentioning

confidence: 39%

Circular RNA Hsa_Circ_0091579 Serves as a Diagnostic and Prognostic Marker for Hepatocellular Carcinoma

Zhang

Lin

2018

Cell Physiol Biochem

View full text Add to dashboard Cite

show abstract

“…Studies have revealed that circRNAs play important regulatory roles in gene expression and may account for initiation and development of cancers or noncancerous diseases . According to previous researches, circular RNA ciRS‐7 (Cdr1as), hsa_circ_0001649 and hsa_circ_0005075, are differently expressed between HCC tissues and adjacent normal tissues …”

Section: Discussionmentioning

confidence: 99%

“…Its primers were 5′‐ACAGTCAGAAAGCCTCTCCAG‐3′ and 5′‐GCCTCCAAACCCAGTATTCCAT‐3′. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) mRNA was used as a reference . The sequences of GAPDH’s primers were as follows: 5′‐TCGACAGTCAGCCGCATCTTCTTT‐3′ and 5′‐ACCAAATCCGTTGACTCCGACCTT‐3′.…”

Section: Methodsmentioning

confidence: 99%

“…As regulatory noncoding RNAs, microRNAs (miRNAs) and long noncoding RNAs (lncRNAs) have been studied for several years. Nowadays, circular RNAs (circRNAs), a new type of regulatory noncoding RNAs, are becoming the highlight RNA molecules . CircRNAs are a class of endogenous RNAs with a stable structure formed by special loop splicing .…”

Section: Introductionmentioning

confidence: 99%

“…The functions of circRNAs include acting as miRNA sponges and regulating gene expression through a circRNA‐miRNA‐mRNA pathway, etc . Increasing studies have demonstrated that circRNAs play a crucial role in various biologic processes such as cell development, proliferation, metastasis, fate decision, migration, and invasion …”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Circular RNA 0068669 as a new biomarker for hepatocellular carcinoma metastasis

Yao

Chen

Shao

et al. 2018

Clinical Laboratory Analysis

Self Cite

View full text Add to dashboard Cite

show abstract

Circular RNAs in hepatocellular carcinoma: Functions and implications

Jiang

et al. 2018

Cancer Medicine

Self Cite

109

View full text Add to dashboard Cite

At present, as hotspot members of the noncoding RNA network, circular RNAs (circRNAs) with distinct properties and diverse pathophysiological functions are being increasingly delineated. CircRNAs play roles at the epigenetic, transcriptional and posttranscriptional regulatory levels. Major studies have focused on their functions as efficient microRNA sponges. The validated number of endogenous circRNAs involved in hepatocellular carcinoma (HCC) continues to increase. Altered circRNA expression is associated with HCC occurrence, invasion, and metastasis. Moreover, the aberrant expression of circRNAs is also significantly related to HCC tumor stage, size, differentiation and metastasis. Because they are exceptionally stable, highly conserved and have tissue‐specific expression patterns, some circRNAs, including hsa_circ_0004018, hsa_circ_0003570, and hsa_circ_0005075, may be potential markers for the diagnosis of HCC. We herein summarize the current knowledge of HCC‐associated circRNAs and present their implications for carcinogenesis and their potential value as diagnostic and prognostic biomarkers. Finally, we discuss the future directions of studies on HCC‐associated circRNAs.

show abstract

Decreased expression of hsa_circ_0003570 in hepatocellular carcinoma and its clinical significance

Abstract: These results indicated that hsa_circ_0003570 expression levels were associated with HCC clinicopathological characteristics.

Cited by 66 publications

References 35 publications

Circular RNA Hsa_Circ_0091579 Serves as a Diagnostic and Prognostic Marker for Hepatocellular Carcinoma

Circular RNA Hsa_Circ_0091579 Serves as a Diagnostic and Prognostic Marker for Hepatocellular Carcinoma

Circular RNA 0068669 as a new biomarker for hepatocellular carcinoma metastasis

Circular RNAs in hepatocellular carcinoma: Functions and implications

Contact Info

Product

Resources

About