Decoupling from yolk sac is required for extraembryonic tissue spreading in the scuttle fly Megaselia abdita

Abstract

Evolutionary novelty can be generally traced back to continuous changes rather than disruptive transformations, yet the sudden appearance of novel developmental traits is not well understood. Here we use the extraembryonic amnioserosa in Drosophila melanogaster as example for a suddenly and newly evolved epithelium, and we ask how this tissue originated by gradual transitions from its two ancestors, amnion and serosa. To address this question, we used in toto time-lapse recordings to analyze an intermediate mode of extraembryonic development in the scuttle fly Megaselia abdita. Our results suggest that the amnioserosa evolved by loss of serosa spreading without disrupting the developmental programs of serosa and amnion. Our findings imply that the Drosophila amnioserosa has retained properties of the ancient serosa and, more generally, indicate that non-autonomous interactions between tissues can be a compelling variable for the evolution of epithelial properties. Impact StatementThe Drosophila amnioserosa originated as a composite extraembryonic epithelium by loss of epithelial spreading and rather than changes in amnion or serosa tissue differentiation.

Tissue-Scale Mechanical Coupling Reduces Morphogenetic Noise to Ensure Precision during Epithelial Folding

“…Light sheet microscopy imaging was performed on a MuVi-SPIM essentially as described previously (Caroti et al, 2018;de Medeiros et al, 2015). Briefly, embryos were mounted in gelrite gel and imaged using a pair of 253 water immersion objectives (CFI75 Apo LWD 25XW, Nikon; N.A.…”

Regionalized tissue fluidization is required for epithelial gap closure during insect gastrulation

“…In other epiboly systems however, cell division does not occur, and thus other unknown mechanisms have to alleviate builtup stress. For example, in many insect taxa, the developing embryo is completely surrounded by a protective epithelial cell layer of extraembryonic fate called the serosa [6][7][8][9][10] . In the red flour beetle, Tribolium castaneum, extraembryonic serosal cells are initially specified as an anterior cap of the cellular blastoderm, which subsequently spreads over the gastrulating embryonic part of the blastoderm 11 .…”

Single gene initiates evolution of epithelial architecture and function

“…To visualize membranes, a GAP43-eGFP fusion construct was used. To obtain a template for mRNA synthesis, the Gap43-eGFP coding sequence was generated by in-frame Gibson cloning of the Gap43 encoding sequence, a short linker (GSAGSAAGSGEV), and a previously published pSP vector with 3’-terminal eGFP pSP-Mab-bsg-eGFP 60 . A fluorescent reporter for subcellular Diaphanous (Dia) localization was generated using the GFP-Dia-N fragment that was described previously 38 .…”

“…The fragment was amplified by PCR with primer pair 5’-TAATACGACTCACTATAGGGAGACCA CGCTGTTGACAAGAGCGGATCGA/5’-TAATACGACTCACTATAGGGAGACCACCCTCGCATTGTTGGCGCATATG with included T7 promotors; dsRNA synthesis was carried out as described 17 . Lifeact-mCherry was generated as a recombinant protein as described 60 .…”