dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in <i>Arabidopsis thaliana</i> genetics

Neff, Michael M.; Neff, Joseph; Chory, Joanne; Pepper, Alan E.

doi:10.1046/j.1365-313x.1998.00124.x

Cited by 662 publications

(464 citation statements)

References 16 publications

Supporting

Mentioning

457

Contrasting

Unclassified

Order By: Relevance

“…We generated the double mutants by standard genetic crosses, following the mutations with cleavedamplified polymorphic sequence (CAPS) markers. When the mutation did not lead to a change in a restriction site, we generated derived CAPS markers using the dCAPS web tool (Neff et al, 1998). The Etr1-1 (Hua and Meyerowitz, 1998), NahG (Morris et al, 2000), rar1-10 , sgt1b , coi1-1 (Xie et al, 1998), pad4-1 (Nishimura et al, 2003), and npr1-1 (Nishimura et al, 2003) primers have been described previously.…”

Section: Double Mutant Constructionmentioning

confidence: 99%

ArabidopsisPEN3/PDR8, an ATP Binding Cassette Transporter, Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration

et al. 2006

View full text Add to dashboard Cite

Arabidopsis thaliana is a host to the powdery mildew Erysiphe cichoracearum and nonhost to Blumeria graminis f. sp hordei, the powdery mildew pathogenic on barley (Hordeum vulgare). Screening for Arabidopsis mutants deficient in resistance to barley powdery mildew identified PENETRATION3 (PEN3). pen3 plants permitted both increased invasion into epidermal cells and initiation of hyphae by B. g. hordei, suggesting that PEN3 contributes to defenses at the cell wall and intracellularly. pen3 mutants were compromised in resistance to the necrotroph Plectosphaerella cucumerina and to two additional inappropriate biotrophs, pea powdery mildew (Erysiphe pisi) and potato late blight (Phytophthora infestans). Unexpectedly, pen3 mutants were resistant to E. cichoracearum. This resistance was salicylic acid–dependent and correlated with chlorotic patches. Consistent with this observation, salicylic acid pathway genes were hyperinduced in pen3 relative to the wild type. The phenotypes conferred by pen3 result from the loss of function of PLEIOTROPIC DRUG RESISTANCE8 (PDR8), a highly expressed putative ATP binding cassette transporter. PEN3/PDR8 tagged with green fluorescent protein localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. PEN3/PDR8 may be involved in exporting toxic materials to attempted invasion sites, and intracellular accumulation of these toxins in pen3 may secondarily activate the salicylic acid pathway.

show abstract

Section: Double Mutant Constructionmentioning

confidence: 99%

ArabidopsisPEN3/PDR8, an ATP Binding Cassette Transporter, Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration

et al. 2006

View full text Add to dashboard Cite

show abstract

“…Sequence analysis of pdgfra in wild-type and b1059 embryos revealed an adenosine-tothymidine nucleotide change resulting in an I855N missense mutation, thus placing a charged residue in the hydrophobic core of the kinase C-lobe in the second tyrosine kinase domain of the receptor. pdgfra b1059 mutants were identified by either phenotype or PCR amplification using dCAPs primers 40 , forward: 5' TGTCTCCAAAGGAAGCGTG 3' and reverse: 5' ACCGAGAGAGAAGATCTCCCATAACTAG 3', followed by digestion with SpeI, resulting in a wild-type fragment of 263 bp and a b1059 fragment of 239 bp. Throughout the text we use pdgfra + to refer to embryos with either pdgfra +/-or pdgfra +/+ genotypes.…”

Section: Zebrafish Care and Usementioning

confidence: 99%

MicroRNA Mirn140 modulates Pdgf signaling during palatogenesis

et al. 2008

View full text Add to dashboard Cite

Disruption of signaling pathways such as those mediated by Shh or Pdgf causes craniofacial disease, including cleft palate. The role that microRNAs play in modulating palatogenesis, however, is completely unknown. We show, in zebrafish, that the microRNA Mirn140 negatively regulates Pdgf signaling during palatal development and we provide a mechanism for how disruption of Pdgf signaling causes palatal clefting. The pdgf-receptor alpha (pdgfra) 3' UTR contains a Mirn140 binding site functioning in the negative regulation of Pdgfra protein levels in vivo. Both pdgfra mutants and Mirn140-injected embryos share panoply of facial defects including clefting of the crestderived cartilages that develop in the roof of the larval mouth. Concomitantly, the oral ectoderm beneath where these cartilages develop loses pitx2 and shha expression. Mirn140 modulates Pdgfmediated attraction of cranial neural crest cells to the oral ectoderm, where crest-derived signals are necessary for oral ectodermal gene expression. Both Mirn140 loss-of-function and pdgfra overexpression alters palatal shape and causes neural crest cells to accumulate around the optic stalk, a source of the ligand Pdgfaa. Conserved molecular genetics and expression patterns of mirn140 and pdgfra suggest that their regulatory interactions are ancient methods of palatogenesis that provide a candidate mechanism for cleft palate.Cleft palate and other craniofacial diseases are common in humans and have complex cellular and genetic etiologies. In amniotes, the palate serves to separate the nasal and oral cavities and is generated through an intricate series of morphogenic events that include early neural crest cell migration and cell-cell signaling during the formation of facial prominences, as well as later generation and fusion of palatal shelves. While later events involving palatal shelves have not been described in zebrafish, palatal precursors migrate both rostral and caudal to the eye to condense upon the oral ectoderm in amniotes 1 as well as zebrafish 2,3 and evidence continues to accumulate that the early signaling environment governing palatogenesis is also largely equivalent [3][4][5][6] . For instance, Hh signaling is crucial for palatogenesis in humans and zebrafish 3,4,7 . Zebrafish and amniotes also share expression patterns of palatogenic genes such as Shh 4,8 , Fgf8 4,9,10 and Pdgf receptor alpha (Pdgfra) [11][12][13] .In mouse, the Pdgf family consists of four soluble ligands, Pdgfa, Pdgfb, Pdgfc, and Pdgfd as well as two receptor tyrosine kinases, Pdgfra and Pdgfrb 14 . Pdgf signaling regulates a myriad of biological processes as demonstrated by analyses of mouse Pdgf ligand and receptor mutants 14 . Mice null for Pdgfra have a facial clefting phenotype that includes cleft palate 12,13 . This facial phenotype is fully recapitulated in mice doubly mutant for Pdgfa and Pdgfc 15. Most Pdgfc mutants have cleft palate 15 MicroRNAs (miRNAs) provide a unique mechanism for modulating signaling pathways [17][18][19][20] . Skeletogenic, including...

show abstract

“…Progeny from these crosses were grown, DNA was isolated (Murray and Thompson, 1980), and genotypes were determined by using derived cleaved amplified polymorphic sequence primers (Neff et al, 1998). For ddm1-2, DDM1f (5Ј-CAGATCTCTACCCTCCTGT-3Ј) and ddm1-2dRsa (5Ј-TGAGCTACGAGCCATGGGTTTGTGAAACGTA-3Ј) primControl of Seed Development by FIE and MEA 2379 ers were used to amplify DNA by PCR.…”

Section: Measuring the Effect Of Ddm1-2 On Transmission Of A Maternalmentioning

confidence: 99%

Mutations in the FIE and MEA Genes That Encode Interacting Polycomb Proteins Cause Parent-of-Origin Effects on Seed Development by Distinct Mechanisms

et al. 2000

View full text Add to dashboard Cite

In flowering plants, two cells are fertilized in the haploid female gametophyte. Egg and sperm nuclei fuse to form the embryo. A second sperm nucleus fuses with the central cell nucleus, which replicates to generate the endosperm, a tissue that supports embryo development. The FERTILIZATION-INDEPENDENT ENDOSPERM ( FIE ) and MEDEA ( MEA ) genes encode WD and SET domain polycomb proteins, respectively. In the absence of fertilization, a female gametophyte with a loss-of-function fie or mea allele initiates endosperm development without fertilization. fie and mea mutations also cause parent-of-origin effects, in which the wild-type maternal allele is essential and the paternal allele is dispensable for seed viability. Here, we show that FIE and MEA polycomb proteins interact physically, suggesting that the molecular partnership of WD and SET domain polycomb proteins has been conserved during the evolution of flowering plants. The overlapping expression patterns of FIE and MEA are consistent with their suppression of gene transcription and endosperm development in the central cell as well as their control of seed development after fertilization. Although FIE and MEA interact, differences in maternal versus paternal patterns of expression, as well as the effect of a recessive mutation in the DECREASE IN DNA METHYLATION1 ( DDM1 ) gene on mutant allele transmission, indicate that fie and mea mutations cause parent-of-origin effects on seed development by distinct mechanisms. INTRODUCTIONFlowering plant reproduction involves fertilization of two cells (reviewed in van Went and Willemse, 1984). Within the Arabidopsis ovule, the female gametophyte consists of an egg cell and two synergid cells at the micropylar end, a central cell in the middle, and three antipodal cells at the chalazal end. All are haploid except for the central cell, which contains two polar nuclei that fuse to form a diploid nucleus. Reproduction is initiated when an entering pollen tube discharges two genetically identical haploid sperm cells. Fertilization of the egg generates the diploid embryo, which passes through morphologically defined stages (globular, heart, torpedo, walking stick, early maturation, and maturation) (Goldberg et al., 1994;Jurgens and Mayer, 1994). During embryo development, two organ systems (axis and cotyledon) and three tissue layers (protoderm, procambium, and ground meristem) are specified (Lindsey and Topping, 1993;Jurgens, 1994;Meinke, 1994).Fertilization of the central cell generates the triploid endosperm, for which the pattern of development differs dramatically from that of the embryo. Arabidopsis endosperm development is characteristic of nuclear endosperm development in angiosperms (Mansfield and Briarty, 1990a;Webb and Gunning, 1991;Berger, 1999;Brown et al., 1999). The Arabidopsis primary endosperm nucleus replicates without cytokinesis to form a syncytium of nuclear-cytoplasmic domains that migrate to the periphery of the expanding central cell (Brown et al., 1999). When the embryo is at the globular/heart transi...

show abstract

dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics

Cited by 662 publications

References 16 publications

ArabidopsisPEN3/PDR8, an ATP Binding Cassette Transporter, Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration

ArabidopsisPEN3/PDR8, an ATP Binding Cassette Transporter, Contributes to Nonhost Resistance to Inappropriate Pathogens That Enter by Direct Penetration

MicroRNA Mirn140 modulates Pdgf signaling during palatogenesis

Mutations in the FIE and MEA Genes That Encode Interacting Polycomb Proteins Cause Parent-of-Origin Effects on Seed Development by Distinct Mechanisms

Contact Info

Product

Resources

About