Data on microsatellite markers in Colletotrichum gloeosporioides s.l., polymorphism levels and diversity range

Penet, Laurent; Briand, Sophie; Pétro, Dalila; Bussière, François; Guyader, Sébastien

doi:10.1016/j.dib.2017.05.012

Cited by 5 publications

(6 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our lab recently developed microsatellite marker sets for C. gloeosporioides , with local historical strain records demonstrating high levels of polymorphism [ 36 ], confirming previous regional analysis [ 37 ]. Given the high-resolution ability of these markers, we investigated the existence of a potentially lower-scale structure of polymorphism in the Lesser Antilles, with a focus on the naturally constraining archipelago structure of the environment.…”

Section: Introductionsupporting

confidence: 71%

“…Genotypic stability was verified by randomly retesting with secondary independent PCR amplification. The primers had PCR conditions consisting of a denaturation stage at 95 • C for 5 min followed by 40 cycles at 95 • C for 30 s, 59 • C for 30 s, 72 • C for 30 s (more details in [36]).…”

Section: Methodsmentioning

confidence: 99%

“…Nevertheless, 3 strains also amplified fragments diagnosing C. acutatum , and were further dismissed from the study sample. We genotyped the strains for 4 microsatellite loci recently developed in the lab (markers Cg150, Cg68, Cg71, Cg92) [ 36 ], with the following forward and reverse primers, respectively: TACCAGGGGTGGCAGCTC and GGTCCAGGGACTCAAGCTC for Cg150, TGGTCTGCTTCTCGACACTG and AGCCAAGAGACCAAGCAAGA for Cg68, TGATGGTTGTCATGGGATTC and GATCATGTCTCCATCCGCTC for Cg71 and CATTTTCCACAGCCCACAC and GCAGCAGGTGTGAGAAGAGA for Cg92. Genotypic stability was verified by randomly retesting with secondary independent PCR amplification.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

High Genetic Diversity and Structure of Colletotrichum gloeosporioides s.l. in the Archipelago of Lesser Antilles

Dentika,

Blazy,

Alleyne

et al. 2023

JoF

Self Cite

View full text Add to dashboard Cite

Colletotrichum gloeosporioides is a species complex of agricultural importance as it causes anthracnose disease on many crop species worldwide, and strong impact regionally on Water Yam (Dioscorea alata) in the Caribbean. In this study, we conducted a genetic analysis of the fungi complex in three islands of the Lesser Antilles—Guadeloupe (Basse Terre, Grande Terre and Marie Galante), Martinique and Barbados. We specifically sampled yam fields and assessed the genetic diversity of strains with four microsatellite markers. We found a very high genetic diversity of all strains on each island, and intermediate to strong levels of genetic structure between islands. Migration rates were quite diverse either within (local dispersal) or between islands (long-distance dispersal), suggesting important roles of vegetation and climate as local barriers, and winds as an important factor in long-distance migration. Three distinct genetic clusters highlighted different species entities, though there was also evidence of frequent intermediates between two clusters, suggesting recurrent recombination between putative species. Together, these results demonstrated asymmetries in gene flow both between islands and clusters, and suggested the need for new approaches to anthracnose disease risk control at a regional level.

show abstract

Section: Introductionsupporting

confidence: 71%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

High Genetic Diversity and Structure of Colletotrichum gloeosporioides s.l. in the Archipelago of Lesser Antilles

Dentika,

Blazy,

Alleyne

et al. 2023

JoF

Self Cite

View full text Add to dashboard Cite

show abstract

“…ciggaro and C. siamense ) (Huang et al, ; Liu et al, ; Weir, Johnston, & Damm, ) and C. truncatum species complex ( C. truncatum ) (Damm, Woudenberg, Cannon, & Crous, ). Currently, the advances made in next‐generation sequencing and in modern molecular techniques provide appropriate methods for taxonomic studies, population genetic structure and phylogenetic analyses (Capote, Pastrana, Aguado, & Sánchez‐Torres, ; Moges et al, ; Penet, Briand, Pétro, Bussière, & Guyader, ; Rampersad, ; Sharma & Kulshrestha, ). Because of their high level of polymorphisms and their easy application via multiplexing (Cai et al, ; Capote et al, ), simple sequence repeat (SSR) markers have been widely used for genetic diversity analysis of various plant pathogenic fungi (Bahri, Leconte, Vallavieille‐Pope, & Enjalbert, ; Szabo, ; Winton, Krohn, & Leiner, ).…”

Section: Introductionmentioning

confidence: 99%

Genetic diversity ofColletotrichum gloeosporioidesspecies complex associated withCitruswither‐tip of twigs in Tunisia using microsatellite markers

Bahri

Saadani

Mechichi

et al. 2019

Journal of Phytopathology

View full text Add to dashboard Cite

Anthracnose Citrus disease has been associated with several symptoms worldwide and it is recently compromising Citrus production in the Mediterranean area. Four species complexes are mainly involved: Colletotrichum boninense, C. acutatum, C. gloeosporioides and C. truncatum. In this study, we investigated the genetic diversity of Colletotrichum spp. in Tunisia associated with wither‐tip of twigs on Citrus. Specific primers ITS4‐CgInt allowed the identification of C. gloeosporioides species complex in all the 54 isolates, sampled from three regions and four Citrus species. Overall, our genotypic analysis using 10 SSR markers showed a moderate diversity level in Tunisian C. gloeosporioides population and highlighted that C. gloeosporioides reproduce mainly clonally. In addition, heterothallic isolates were present in our population, suggesting that the pathogen population may undergo parasexual recombinations. The highest genetic diversity in C. gloeosporioides was recorded in Nabeul and on orange, which likely constitutes the area and the host of origin for the Citrus anthracnose disease in Tunisia. In addition, no population subdivision was detected at the geographic, host species or cultivars’ origin levels. However, our study identified two genetic subpopulations and indicated a rapid C. gloeosporioides population change at temporal scale that should be further examined over several consecutive growing seasons in order to understand its population dynamics.

show abstract

“…Within Colletotrichum spp., only C. gloeosporioides has 39 SSR markers identified (Penet et al, 2017) with a range of 2-29 alleles, enabling genetic diversity studies without the need of previous sequencing. However, there are no studies reporting the extensive use of these markers for isolate characterization.…”

Section: Genetic Variabilitymentioning

confidence: 99%

Emergent Ascomycetes in Viticulture: An Interdisciplinary Overview

et al. 2019

View full text Add to dashboard Cite

The reduction of pesticide usage is a current imperative and the implementation of sustainable viticulture is an urgent necessity. A potential solution, which is being increasingly adopted, is offered by the use of grapevine cultivars resistant to its main pathogenic threats. This, however, has contributed to changes in defense strategies resulting in the occurrence of secondary diseases, which were previously controlled. Concomitantly, the ongoing climate crisis is contributing to destabilizing the increasingly dynamic viticultural context. In this review, we explore the available knowledge on three Ascomycetes which are considered emergent and causal agents of powdery mildew, black rot and anthracnose. We also aim to provide a survey on methods for phenotyping disease symptoms in fields, greenhouse and lab conditions, and for disease control underlying the insurgence of pathogen resistance to fungicide. Thus, we discuss fungal genetic variability, highlighting the usage and development of molecular markers and barcoding, coupled with genome sequencing. Moreover, we extensively report on the current knowledge available on grapevine-ascomycete interactions, as well as the mechanisms developed by the host to counteract the attack. Indeed, to better understand these resistance mechanisms, it is relevant to identify pathogen effectors which are involved in the infection process and how grapevine resistance genes function and impact the downstream cascade. Dealing with such a wealth of information on both pathogens and the host, the horizon is now represented by multidisciplinary approaches, combining traditional and innovative methods of cultivation. This will support the translation from theory to practice, in an attempt to understand biology very deeply and manage the spread of these Ascomycetes.

show abstract

Data on microsatellite markers in Colletotrichum gloeosporioides s.l., polymorphism levels and diversity range

Cited by 5 publications

References 16 publications

High Genetic Diversity and Structure of Colletotrichum gloeosporioides s.l. in the Archipelago of Lesser Antilles

High Genetic Diversity and Structure of Colletotrichum gloeosporioides s.l. in the Archipelago of Lesser Antilles

Genetic diversity ofColletotrichum gloeosporioidesspecies complex associated withCitruswither‐tip of twigs in Tunisia using microsatellite markers

Emergent Ascomycetes in Viticulture: An Interdisciplinary Overview

Contact Info

Product

Resources

About