Calbindin-D28K and/or parvalbumin appear to influence the selective vulnerability of motoneurons in amyotrophic lateral sclerosis (ALS). Their immunoreactivity is undetectable in motoneurons readily damaged in human ALS, and in differentiated motoneuron hybrid cells [ventral spinal cord (VSC 4 MATERIALS AND METHODS Construction of pStMCS-PCalb for Retrovirus Packaging.The calbindin-D28K cDNA was cloned from rat brain as follows: total RNA was extracted from rat brain by the guanidinium/cesium chloride method (8). Poly(A)+ RNA was purified by oligo(dT) cellulose (Collaborative Research, Bedford, MA) affinity chromatography. The entire coding sequence (786 bp) of calbindin-D28K was synthesized from the poly(A)+ RNA by reverse transcriptase (GIBCO/BRL)-polymerase chain reaction (PCR, Perkin-Elmer/Cetus) and cloned into the BamHI site of plasmid pGEM-3Z (Promega). The sequences of the oligomers for PCR are TTCGGATCC-ATGGCAGAATCCCACCTGCA for the 5' forward primer and AAAGGATCCTAGTTGTCCCCAGCAGAGAGAAT for the 3' reverse primer (the oligomers were synthesized at the Department of Cell Biology, Baylor College of Medicine). A clone containing the correct complete calbindin-D28K sequence was identified by dideoxynucleotide sequencing (9).The calbindin-D28K cDNA was obtained from the clone pGEM-calbindin by BamHI digestion and cloned into the SmaI site of pPGKbpA (derived from pPGKneo) after filling-in of ends by treatment with the Klenow fragment of DNA polymerase I (Promega). As shown in Fig. 1, this enabled insertion of the calbindin-D28K cDNA downstream of the PGK promoter/enhancer sequence and upstream of a polyadenylylation signal of the growth hormone gene. Orientation of the cDNA was determined by digestion with EcoRI. The resulting construct was digested with XhoI, treated with Klenow polymerase, and subsequently, digested with HindIII. The resulting mixture of fragments were ligated into Stul-and HindlIldigested vector pStMCS. The plasmid pStMCS (kindly provided by John Belmont, Baylor College of Medicine, Houston, TX) is a retroviral vector, containing Moloney murine leukemia virus long terminal repeats. The orientation of the calbindin expression cassette is opposite to that of the long terminal repeat sequences in the final pStMCS-PGK-calbindin (pSt-MCS-PCalb) plasmid (Fig. 1)