Cyclosporine A inhibits the expression of membrane type‐I matrix metalloproteinase in gingiva

Abstract

Cyclosporine A inhibits the expression of membrane type-I MMP in gingiva and it may further reduce the activation of MMP-2.

Extracellular Matrix Molecules: Potential Targets in Pharmacotherapy

“…Furthermore, it also represents a proof of the principle that hereditary diseases, including hereditary ECM diseases, can be treated with proper drugs downstream of the genetic lesion, if the pathogenetic mechanism is understood (Olsen, 2008). Besides being a curative agent for Ullrich congenital muscular dystrophy and Bethlem myopathy, cyclosporine A can beneficially contribute to ECM remodelling by regulating the activity of specific MMPs (Chiu et al, 2009;Saygili et al, 2009). These examples highlight the point that the mechanisms driving fibrogenesis are not necessarily the same as those regulating inflammation (Wynn, 2007(Wynn, , 2008; Sivakumar and Das, 2008) and that there is a specific need to develop drugs targeting the ECM besides developing better drugs for various inflammatory diseases.…”

“…Inhibition of cyclooxygenase enzymes -1 and -2 (Gasparini et al, 2003) Modulation of the synthesis of fibronectin (Ernst et al, 1995), various types of collagen (Ernst et al, 1995;Liu et al, 2007), large chondroitin sulfate proteoglycans (Okada et al, 1994), and HA (Sussmann et al, 2004); suppression of MMP expression, synthesis, and activity (Sadowski and Steinmeyer, 2001;Pavlovic et al, 2006) Other immunosuppressive drugs Cyclosporine A Calcineurin inhibitor (Ho et al, 1996) Differential effect on collagen synthesis and fibrosis (Eickelberg et al, 2001;Fornoni et al, 2001;Waller et al, 2004); inhibition of MMP activity (Fornoni et al, 2001;Chiu et al, 2009;Saygili et al, 2009) Leflunomide Pyrimidine synthesis inhibitor (Fukushima et al, 2007) Inhibitory effect on fibrogenesis (Yao et al, 2004;Si et al, 2007) Methotrexate Inhibitor of dihydrofolate reductase (Warren et al, 2008) Reduction of type IV collagen synthesis and ECM expansion (Yozai et al, 2005); influence on MMP and TIMP production …”

Crosstalk Between Human Monocytic U937 Cells and Gingival Fibroblasts in Coculturally Enhanced Matrix Metalloproteinase‐2 Expression

“…Fibroblasts and inflammatory cells, including monocytes/macrophages, are colocalized in diseased periodontal tissue, where an enhanced expression of MMP‐2 is also observed 8 , 10 . Expression of MMPs in different cells might vary 22,23,34,35 . For instance, MMP‐2 expression is weaker in monocytes/macrophages, 23 , 35 even after stimulation with CyPA 23 or lipopolysaccharide (LPS) 13 .…”

“…PCR conditions were as follows: an initial denaturation at 94°C for 2.5 minutes followed by 30 or 40 cycles at 94°C for 30 seconds, an appropriate annealing temperature of 60°C for 30 seconds, and 72°C for 55 seconds. PCR primer sequences were EMMPRIN, forward 5′‐GGCCAGAAAACGGAGTTCAA‐3′ and reverse 5′‐GCGCTTCTCGTAGATGAAGA‐3′ (492 base pairs [bp]); MMP‐2, forward 5′‐CCACGTGACAAGCCCATGGGGCCCC‐3′ and reverse 5′‐GCAGCCTAGCCAGTCGGATTTGATG‐3′ (480 bp); and glyceraldehyde‐3‐phosphate dehydrogenase sense, forward 5′‐AGCCGCATCTTCTTTTGCGTC‐3′ and reverse 5′‐TCATATTTGGCAGGTTTTTCT‐3′ (816 bp) 22 . Amplified RT‐PCR products were analyzed using 1% agarose gels and visualized using ethidium bromide staining with a camera system ¶¶¶ .…”

Crosstalk between Shh and TGF-β Signaling in Cyclosporine-Enhanced Cell Proliferation in Human Gingival Fibroblasts

“…Cyclosporine A (CsA), a powerful immunosuppressant, is widely used to prevent organ rejection but has significant side effects in oral tissues; one of these side effects is gingival overgrowth, which is characterized by increased proliferation of fibroblasts, epithelial thickening, and overproduction of extracellular matrix components [1]–[4]. Various direct and/or indirect interactions between CsA and gingival fibroblasts have been investigated, including those that involve metabolic and synthetic activities [2], [5]–[8].…”