Cyclosporin-induced dyslipoproteinemia is associated with selective activation of SREBP-2

Abstract

. Cyclosporin-induced dyslipoproteinemia is associated with selective activation of SREBP-2. Am. J. Physiol. 277 (Endocrinol. Metab. 40): E1087-E1094, 1999.-The use of cyclosporin A has contributed greatly to the success of organ transplantation. However, cyclosporin-associated side effects of hypertension, nephrotoxicity, and dyslipoproteinemia have tempered these benefits. Cyclosporin-induced dyslipoproteinemia may be an important risk factor for the accelerated atherosclerosis observed posttransplantation. Using a mouse model, we treated Swiss-Webster mice for 6 days with a daily dose of 20 µg/g body wt of cyclosporin and observed significant elevations of plasma cholesterol, triglyceride, and apolipoprotein B (apoB) levels relative to vehicle-alone treated control animals. Measurement of the rate of secretion of very lowdensity lipoprotein (VLDL) by the liver in vivo showed that cyclosporin treatment led to a significant increase in the rate of hepatic VLDL triglyceride secretion. Total apoB secretion was unaffected. Northern analysis showed that cyclosporin A treatment increased the abundance of hepatic mRNA levels for a number of key genes involved in cholesterol biosynthesis relative to vehicle-alone treated animals. Two key transcriptional factors, sterol regulatory element-binding protein (SREBP)-1 and SREBP-2, also showed differential expression; SREBP-2 expression was increased at the mRNA level, and there was an increase in the active nuclear form, whereas the mRNA and the nuclear form of SREBP-1 were reduced. These results show that the molecular mechanisms by which cyclosporin causes dyslipoproteinemia may, in part, be mediated by selective activation of SREBP-2, leading to enhanced expression of lipid metabolism genes and hepatic secretion of VLDL triglyceride.

Cyclosporin A inhibits apolipoprotein AI gene expression

“…Rats were s.c. injected with CsA (20 mg/kg per day) or olive oil (vehicle alone) for 7 days (Wu et al 1999). Animals were then killed, and whole blood was collected for serum apo AI protein measurement.…”

“…One of the side effects of CsA is hyperlipidemia (Ballantyne et al 1989), in which total cholesterols are high, and HDL and apo AI levels are low. It has been proposed in a mouse model that CsA causes dyslipoproteinemia through selective activation of sterol-regulatory element-binding protein-2, which leads to enhanced expression of lipid metabolism genes and hepatic secretion of VLDL triglyceride (Wu et al 1999). In addition, CsA is reported to inhibit ABCA1-dependent cholesterol efflux with reduced HDL levels in mice (Le Goff et al 2004).…”

7-Dehydrocholesterol–dependent proteolysis of HMG-CoA reductase suppresses sterol biosynthesis in a mouse model of Smith-Lemli-Opitz/RSH syndrome

“…Total RNA was extracted from freshly harvested liver with Trizol (Life Technologies, Bethesda Maryland, USA), according to the manufacturer's recommendation and Northern analysis performed as described previously (30). Mouse cDNA probes for HMG-CoA reductase, HMG-CoA synthase, LDL receptor (LDLR), and squalene synthase have been described previously (30) and were gifts from Hitoshi Shimano and Jay Horton (University of Texas Southwestern Medical Center, Dallas, Texas, USA).…”

“…Total RNA was extracted from freshly harvested liver with Trizol (Life Technologies, Bethesda Maryland, USA), according to the manufacturer's recommendation and Northern analysis performed as described previously (30). Mouse cDNA probes for HMG-CoA reductase, HMG-CoA synthase, LDL receptor (LDLR), and squalene synthase have been described previously (30) and were gifts from Hitoshi Shimano and Jay Horton (University of Texas Southwestern Medical Center, Dallas, Texas, USA). Dhcr7 mRNA was measured by RT-PCR after first isolating total RNA from 5 mg of mouse liver and brain, then carrying out oligo dT-primed reverse transcription of 2 µg of RNA followed by PCR using the sense/antisensespecific primer pair for the 3′ transcript of Dhcr7 (915: 5′gaccatcgacatctgccatgacc/ 1870: 5′ggagcctagct-caccaggatgg; fragment size: 955 bp).…”

Energy Metabolism in Diabetic and Nondiabetic Heart Transplant Recipients

“…This means that strict glycemic control may prevent the development or progression of diabetic complications in diabetic heart recipients, but the overinsulinization consequent to intensive insulin treatment may even accelerate (theoretically) the atherosclerotic disease in transplanted hearts (27). Also cyclosporin may play a dual role in the progression of diabetic complications: in fact, it was shown to induce alteration of lipid profile (28,29). The IMCL content correlates well with insulin action.…”