Cyclin-dependent kinase 19 upregulation correlates with an unfavorable prognosis in hepatocellular carcinoma

Abstract

Objectives Cyclin-dependent kinase 19 (CDK19) is a component of the mediator coactivator complex, which is required for transcriptional activation. In this study, we utilized public databases and wet-bench hepatic cell line experiments to elucidate the potential roles of CDK19 in hepatocellular cancer (HCC). Materials and methods We studied the relationships between CDK19 expression and several clinical features related to HCC via the Oncomine and UALCAN databases. The prognostic value of CDK19 was tested using the Kaplan–Meier Plotter database. We presented the mutations of CDK19 and addressed the relation of CDK19 expression with immune cell infiltration by means of the cBioPortal, Catalogue of Somatic Mutations in Cancer (COSMIC) and Tumor IMmune Estimation Resource (TIMER) databases. Hub genes were obtained and further analyzed using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database. To test the in silico findings, we knocked down CDK19 with short hairpin RNA (shRNA) technology in two hepatic cell lines and conducted several functional characterization experiments. Results Marked CDK19 upregulation was found in HCC tissues versus normal liver tissues, and CDK19 mRNA expression had high diagnostic value in HCC patients. Subgroup analysis showed that CDK19 overexpression was associated with sex, tumor stage and TP53 mutation status. The prognostic value of CDK19 upregulation for overall survival (OS) was significant in patients with stage 2–3, stage 3–4, and grade 2 disease. One percent of the patients had CDK19 mutations, but no relationship between CDK19 mutation and prognosis was observed. CDK19 was positively correlated with the abundances of CD4 + T cells, macrophages and dendritic cells. We identified 10 genes correlated with CDK19, 8 of which presented excellent prognostic value in HCC. These hub genes were directly involved in cell division and regulation of the G2/M cell cycle transition. Protein–protein interaction (PPI) and pathway predictions indicated that CDK19 is highly likely to be involved in several cellular functions, such as proliferation, migration, and invasion. These functions were strongly interfered from two independent hepatic cell lines after CDK19 knockdown. Conclusions CDK19 could be a prognostic marker in HCC, and its therapeutic potential in HCC needs further study.

Prognostic biomarker SMARCC1 and its association with immune infiltrates in hepatocellular carcinoma

“…To obtain stable SMARCC1 knockdown HepG2 and Huh7 cell lines, we used a lentivirus-based short hairpin RNA (shRNA) delivery system, and the targeting sequences were GCGGATTTCAACCAAGAATGA (shRNA1) and GGGACTCGTTAATTACCAAGT (shRNA2). All the steps of a previous study were followed [ 25 ]. Then, PLC-8024 cell lines stably expressing SMARCC1 were obtained by transfection with the pCDH-3 × flag vector containing SMARCC1 DNA and selected in 10 µg/ml G418 for 14 days.…”