Cyclin D1 Induction Preceding Neuronal Death via the Excitotoxic NMDA Pathway Involves Selective Stimulation of Extrasynaptic NMDA Receptors and JNK Pathway

Abstract

The N-methyl-D-aspartate subtype of ionotropic glutamate receptors (NMDARs) signals both prosurvival and death-inducing (excitotoxic) neuronal responses via synaptically (synaptic NMDAR) and extrasynaptically (extrasynaptic NMDAR) located receptor pools, respectively. Both receptor pools share similar, though not identical, postreceptor signaling molecules. The activation of the extrasynaptic NMDAR pathway is predominant. Therefore, in order to inhibit the extrasynaptic death pathway while sparing synaptic responses, it is critical to identify selective postreceptor effectors of extrasynaptic NMDARs. The present study addressed these issues by using primary cultures of rat hippocampal neurons and a pharmacological protocol of selective NMDAR stimulation for Western blot and immunocytochemistry analyses. We found that the activation of extrasynaptic NMDARs, either alone or together with synaptic NMDARs, triggers cyclin-D1-associated re-entry into the cell cycle, which does not proceed beyond the S-phase. This aberrant cell cycle re-entry is particularly associated with neuronal death triggered specifically via extrasynaptic NMDAR-induced c-Jun N-terminal protein kinase (JNK). In addition, NMDA-elicited neuronal death was significantly inhibited by pharmacological blockade of JNK-mediated cyclin D1 expression or by silencing cyclin D1 RNA. Taken together, these data suggest a causal relationship between cyclin D1 induction and extrasynaptic NMDAR-triggered neuronal death along the excitotoxic NMDA pathway. Therefore, cyclin D1 may be a putative target for the development of neuroprotective strategies sparing physiological synaptic NMDAR signaling.

The expression of apoptosis inducing factor (AIF) is associated with aging-related cell death in the cortex but not in the hippocampus in the TgCRND8 mouse model of Alzheimer’s disease

“…For example, cyclin D1 induction is related to excitotoxicity, which is known to be tightly associated with oxidative stress and is correlated with increasing Aβ levels [43,44]. Moreover, cyclin D1 induction has been involved in neuronal death, as shown in hippocampal [45,46] and cortical [47,48] neurons, in vitro, as well as animal and human AD post-mortem tissues [49,50]. In the current study, no difference was noted with age in any of the regions studied (Figure  4C).…”

“…Although cyclin D1 induction has been associated with Aβ-induced cell death, in vitro and in human post-morten AD brain tissues [45,48-50], the data are much less conclusive regarding the relationship of cyclin D1/Aβ in AD mouse models [50,62]. …”

Expression of cell cycle proteins in cortical neurons—Correlation with glutamate‐induced neurotoxicity

“…In primary cultures of rat hippocampal neurons activation of NMDA receptors triggered cyclin D1 associated re‐entry into the cell cycle, which did not proceed beyond the S‐phase, however, stimulated cell death. . Evidence suggests that besides the increased levels, the sublocalization of cyclin D1 also plays an important role and it might contribute to apoptosis in neurons .…”

Leptin-dependent neurotoxicity via induction of apoptosis in adult rat neurogenic cells

“…The chosen forward sequence was: 5′TTTGA CCTGCGCGCCCTCCGTTTCTTTCAAGAGAAGAAACGGAGGGCGCGCAGGTCTTTTT 3′ and the chosen reverse sequence was 5′CTAGAAAAAGACCTGCGCGCCCTCCGTTTCTTCTCTTG AAAGAAACGGAGGGCGCGCAGGT 3′. After annealing of synthesized single strand cDNAs, the resulting shRNA was ligated into mU6pro vector (Promega) and resulting plasmid was amplified as previously described (Efthimiadi et al, 2012 ). The primers used to identify mU6pro vector containing the chosen shRNA sequence were: F1F (CATTCAGGCTGCGCAACTGTTG) and M13R2 (CACAGGAAACAGCTATGACCAT) giving rise to an amplified fragment of 810 bp.…”