Cyclic Dipeptides Mediating Quorum Sensing and Their Biological Effects in Hypsizygus Marmoreus

Abstract

A novel quorum sensing (QS) system was discovered in Serratia odorifera, the symbiotic bacterium of Hypsizygus marmoreus. This system uses cyclo(Pro-Phe), cyclo(Pro-Tyr), cyclo(Pro-Val), cyclo(Pro-Leu), cyclo(Tyr-Leu), and cyclo(Tyr-Ile) as autoinducers. This discovery is the first attempt to characterize cyclic dipeptides as QS signaling molecules in S. odorifera and improves the classical QS theory. Significantly, except for cyclo(Tyr-Leu), these QS autoinducers can increase the transcription level of lignin-degrading enzyme genes of H. marmoreus. The cyclo(Pro-Phe) can increase the activity of extracellular laccase (1.32-fold) and manganese peroxidase (20%), which may explain why QS potentially regulates the hyphal growth, primordium formation, and fruit body development of H. marmoreus. Furthermore, it was demonstrated that the cyclo(Tyr-Ile) biosynthesis in S. odorifera was catalyzed by the nonribosomal peptide synthetase (NRPS). This study supports exploring the growth and development of H. marmoreus promoted by its symbiotic bacteria at QS signal transduction level.

Study on the community structure and function of symbiotic bacteria from different growth and developmental stages of Hypsizygus marmoreus

“…Interestingly, some members of the genus Serratia exhibit quorum-sensing [31]. Serratia odorifera HZSO-1 can also secrete N-acyl homoserine lactones to the external environment as signaling molecules under the regulation of the quorum-sensing system when it perceives a critical cell density [20]. The signaling molecule is a kind of hormone that plays a significant role in the interaction between bacteria and mushrooms [34,35].…”

“…The addition of sterilized fermentation broth of Serratia odorifera HZSO-1 in the substrates significantly promoted the growth of the H. marmoreus fruiting body, shortened the fruiting cycle, and brought forward the harvest time by 3-4 days. Generally, the metabolites produced by Serratia odorifera HZSO-1 contain quorum sensing molecules as described in our published paper [20], which can stimulate H. marmoreus to secret some lignin-degrading enzymes (laccase, peroxidase, cellulase, and chitinase). These enzymes accelerated the decomposition of cultivation substrates, promoted the growth and development of H. marmoreus, and further increase yield of fruiting bodies.…”

“…Isolation and identification of dominant symbiotic bacteria and their effects on the growth and development of H. marmoreus [20,42,43] According to the high-throughput sequencing results, the predominant symbiotic bacteria (Serratia genera) were isolated from cultivation bags when H. marmoreus entered the matured period. Single colony isolated by dilution plating procedure [44] was identified by PCR with universal primers targeting the 16S rDNA gene (16S-F: AGAGTTTGATCCTGGCTCAG; 16S-R: GGTTACCT TGTTACGACTT).…”

Study on the community structure and function of symbiotic bacteria from different growth and developmental stages of Hypsizygus marmoreus

“…The addition of sterilized fermentation broth of Serratia odorifera HZSO-1 in the substrates signi cantly promoted the growth of the H. marmoreus fruiting body, shortened the fruiting cycle, and brought forward the harvest time by 3-4 days. Generally, the metabolites produced by Serratia odorifera HZSO-1 contain quorum sensing molecules as described in our published paper [20], which can stimulate H. marmoreus to secret some lignin-degrading enzymes (laccase, peroxidase, cellulase, and chitinase). These enzymes accelerated the decomposition of cultivation substrates, promoted the growth and development of H. marmoreus, and further increase yield of fruiting bodies.…”

Study on the community structure and function of symbiotic bacteria at different growth and developmental stages of Hypsizygus marmoreus

“…Isolation and identi cation of dominant symbiotic bacteria and their effects on the growth and development of H. marmoreus [31,40,41] According to the high-throughput sequencing results, the predominant symbiotic bacteria (Serratia genera) were isolated from cultivation bags when H. marmoreus entered the matured period. The single colony isolated by dilution plating procedure [42] was identi ed by PCR with universal primers targeting the 16S rDNA gene (16S-F: AGAGTTTGATCCTGGCTCAG; 16S-R: GGTTACCTTGTTACGACTT).…”