Curcumin induces Apaf-1-dependent, p21-mediated caspase activation and apoptosis

Gogada, Raghu; Amadori, Michael; Zhang, Honghao; Jones, Anthony; Verone, Alissa R.; Pitarresi, Jason R.; Jandhyam, S; Prabhu, Varun V.; Black, Jennifer D.; Chandra, Dhyan

doi:10.4161/cc.10.23.18292

Cited by 62 publications

(41 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Non-selective inhibition of caspase activities reduced the levels of DNA-fragmentation, but nevertheless it did not completely hamper the apoptogenic activity of the tested curcumin formulations. These findings well corroborate the reported involvement of both caspase-dependent (Anto et al, 2002;Chang et al, 2014;Gogada et al, 2011;Kuo et al, 2011;Li et al, 2014;Sikora et al, 2006;Singh et al, 2009;Wu et al, 2005;Wu et al, 2010)) and independent mechanisms (Hilchie et al, 2010;Lu et al, 2009;Piwocka et al, 2002;Piwocka et al, 2001;Thayyullathil et al, 2008) to underlie the proapoptotic effects of the polyphenol.…”

Section: Discussionsupporting

confidence: 90%

Curcumin loaded pH-sensitive hybrid lipid/block copolymer nanosized drug delivery systems

Jelezova

Drakalska

Momekova

et al. 2015

European Journal of Pharmaceutical Sciences

View full text Add to dashboard Cite

Curcumin is a perspective drug candidate with pleiotropic antineoplastic activity, whose exceptionally low aqueous solubility and poor pharmacokinetic properties have hampered its development beyond the preclinical level. A possible approach to overcome these limitations is the encapsulation of curcumin into nano-carriers, incl. liposomes. The present contribution is focused on feasibility of using hybrid pH-sensitive liposomes, whereby curcumin is entrapped as a free drug and as a water soluble inclusion complex with PEGylated tertbutylcalix[4]arene, which allows the drug to occupy both the phospholipid membranes and the aqueous core of liposomes. The inclusion complexes were encapsulated in dipalmithoylphosphathydilcholine:cholesterol liposomes, whose membranes were grafted with a poly(isoprene-b-acrylic acid) diblock copolymer to confer pH-sensitivity. The liposomes were characterized by DLS, ζ-potential measurements, cryo-TEM, curcumin encapsulation efficacy, loading capacity, and in vitro release as a function of pH. Free and formulated curcumin were further investigated for cytotoxicity, apoptosis-induction and caspase-8, and 9 activation in chemosensitive HL-60 and its resistant sublines HL-60/Dox and HL-60/CDDP. Formulated curcumin was superior cytotoxic and apoptogenic agent vs. the free drug. The mechanistic assay demonstrated that the potent proapoptotic effects of pH-sensitive liposomal curcumin presumably mediated via recruitment of both extrinsic and intrinsic apoptotic pathways in both HL-60 and HL-60/CDDP cells.

show abstract

Section: Discussionsupporting

confidence: 90%

Curcumin loaded pH-sensitive hybrid lipid/block copolymer nanosized drug delivery systems

Jelezova

Drakalska

Momekova

et al. 2015

European Journal of Pharmaceutical Sciences

View full text Add to dashboard Cite

show abstract

“…Once caspase-3 is activated, apoptotic cell death is irreversible [43, 44]. Interestingly, it has previously been shown that curcumin induces concentration- and time-dependent caspase-3 activation in MDA-MB-231 cells [45]. To corroborate the induction of apoptosis by dienone 2c in our present study, caspase-3 activation was assessed.…”

Section: Discussionmentioning

confidence: 72%

A novel curcumin-like dienone induces apoptosis in triple-negative breast cancer cells

et al. 2016

View full text Add to dashboard Cite

Purpose According to the World Health Organization (WHO), breast cancer is the most common cancer affecting women worldwide. In the USA ~12.3 % of all women are expected to be diagnosed with various types of breast cancer, exhibiting varying degrees of therapeutic response rates. Therefore, the identification of novel anti-breast cancer drugs is of paramount importance. Methods The 1,5-diaryl-3-oxo-1,4-pentadienyl pharmacophore was incorporated into a number of cytotoxins. Three of the resulting dienones, 2a, 2b and 2c, were tested for their antineoplastic potencies in a variety of human breast cancer-derived cell lines, including the triple negative MDA-MB-231 cell line and its metastatic variant, using a live-cell bio-imaging method. Special emphasis was put on dienone 2c, since its anti-cancer activity and its mode of inflicting cell death have so far not been reported. Results We found that all three dienones exhibited potent cytotoxicities towards the breast cancer-derived cell lines tested, whereas significantly lower toxicities were observed towards the non-cancerous human breast cell line MCF-10A. The dienones 2b and 2c exhibited the greatest selective cytotoxicity at submicromolar concentration levels. We found that these two dienones induced phosphatidylserine externalization in MDA-MB-231 cells in a concentration-dependent manner, suggesting that their cytotoxic effect might be mediated by apoptosis. This possibility was confirmed by our observation that the dienone 2c can induce mitochondrial depolarization, caspase-3 activation, cell cycle disruption and DNA fragmentation in MDA-MB-231 cells. Conclusion Our findings indicate that dienone 2c uses the mitochondrial/intrinsic pathway to inflict apoptosis in triple negative MDA-MB-231 breast cancer-derived cells. This observation warrants further assessment of dienone 2c as a potential anti-breast cancer drug.

show abstract

“…The fold-change in expression levels (using GAPDH and actin as control) was determined by comparative C T method. The primers for Bim, GAPDH, and actin were used as described previously (28,29). The primers Bim forward, GGCCCCTACCTCCCTACA, and Bim reverse, GGGGTTT-GTGTTGATTTGTCA; GAPDH forward, AGCCACATCGC-TCAGACAC, and GAPDH reverse, GCCCAATACGACCAA-ATCC; and actin forward, CTTCGTCGCACATTGTGTCT, and actin reverse, GACAGCGCCAAGTGAAGC were used to amplify the mRNA expression levels.…”

Section: Methodsmentioning

confidence: 99%

Bim, a Proapoptotic Protein, Up-regulated via Transcription Factor E2F1-dependent Mechanism, Functions as a Prosurvival Molecule in Cancer

Gogada

Yadav

Liu

et al. 2013

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Curcumin induces Apaf-1-dependent, p21-mediated caspase activation and apoptosis

Cited by 62 publications

References 54 publications

Curcumin loaded pH-sensitive hybrid lipid/block copolymer nanosized drug delivery systems

Curcumin loaded pH-sensitive hybrid lipid/block copolymer nanosized drug delivery systems

A novel curcumin-like dienone induces apoptosis in triple-negative breast cancer cells

Bim, a Proapoptotic Protein, Up-regulated via Transcription Factor E2F1-dependent Mechanism, Functions as a Prosurvival Molecule in Cancer

Contact Info

Product

Resources

About