2013
DOI: 10.2210/pdb4ihv/pdb
|View full text |Cite
|
Sign up to set email alerts
|

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Help me understand this report

This publication either has no citations yet, or we are still processing them

Set email alert for when this publication receives citations?

See others like this or search for similar articles