Crystal structure of cytochrome P450 CYP105N1 from Streptomyces coelicolor, an oxidase in the coelibactin siderophore biosynthetic pathway

Lim, Young-Ran; Hong, Myoung-Ki; Kim, Jin-Kwang; Doan, Thanh Thi Ngoc; Kim, Dong-Hyun; Yun, Chul‐Ho; Chun, Young‐Jin; Kang, Lin‐Woo; Kim, Donghak

doi:10.1016/j.abb.2012.09.001

Cited by 21 publications

(17 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This unique feature clearly sets this group of enzymes apart from the structurally related non‐Oxy P450 enzymes identified by Dali search for both molecules present in the asymmetric unit (e.g. CYP105‐P1 /‐AS1 /‐N1 , MycG , P450 nor and OleP ). Compared to the OxyB and OxyC structures, in OxyA tei these helices are pulled down toward the heme, whereas in the OxyE structure these helices adopt an even more closed conformation (Fig.…”

Section: Resultsmentioning

confidence: 88%

Structure of OxyA_tei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Haslinger

Cryle

2016

FEBS Letters

View full text Add to dashboard Cite

Edited by Richard CogdellCyclization of glycopeptide antibiotic precursors occurs in either three or four steps catalyzed by Cytochrome P450 enzymes. Three of these enzymes have been structurally characterized to date with the second enzyme along the pathway, OxyA, escaping structural analysis. We are now able to present the structure of OxyA tei involved in teicoplanin biosynthesis -the same enzyme recently shown to be the first active OxyA homolog. In spite of the hydrophobic character of the teicoplanin precursor, the polar active site of OxyA tei and its affinity for certain azole inhibitors hint at its preference for substrates with polar decorations.

show abstract

Section: Resultsmentioning

confidence: 88%

Structure of OxyA_tei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Haslinger

Cryle

2016

FEBS Letters

View full text Add to dashboard Cite

show abstract

“…60 Next, a study of the effect of coelibactin on S. coelicolor sporulation confirmed that Zur, the zinc uptake repressor, regulates coelibactin biosynthesis. 61 Although the biosynthesis of coelibactin has been investigated, 56,62 this metallophore has not yet been isolated from S. coelicolor and structurally elucidated; thus, its coordination chemistry remains to be explored.…”

Section: Siderophores As Zincophoresmentioning

confidence: 99%

Beyond iron: non-classical biological functions of bacterial siderophores

2015

View full text Add to dashboard Cite

Bacteria secrete small molecules known as siderophores to acquire iron from their surroundings. For over 60 years, investigations into the bioinorganic chemistry of these molecules, including fundamental coordination chemistry studies, have provided insight into the crucial role that siderophores play in bacterial iron homeostasis. The importance of understanding the fundamental chemistry underlying bacterial life has been highlighted evermore in recent years because of the emergence of antibiotic-resistant bacteria and the need to prevent the global rise of these superbugs. Increasing reports of siderophores functioning in capacities other than iron transport have appeared recently, but reports of “non-classical” siderophore functions have long paralleled those of iron transport. One particular non-classical function of these iron chelators, namely antibiotic activity, was even documented before the role of siderophores in iron transport was established. In this Perspective, we present an exposition of past and current work into non-classical functions of siderophores and highlight the directions in which we anticipate that this research is headed. Examples include the ability of siderophores to function as zincophores, chalkophores, and metallophores for a variety of other metals, sequester heavy metal toxins, transport boron, act as signalling molecules, regulate oxidative stress, and provide antibacterial activity.

show abstract

“…Our general approach has been described previously (Lim et al ., 2012; Han et al ., 2015). The open reading frame for CYP158A3 was isolated directly by PCR amplification from S. avermitilis cells, and a 6×His-C-terminal tag was appended using forward and reverse primers (5′CGAATCATATGACC-GAGAAA3′, 5′TCTAGACCGGAAGCTTTTAGTGATGGTGATG-GTGATGCCAGGTCACGGGCAG3′).…”

Section: Methodsmentioning

confidence: 99%

“…The expression and purification of CYP158A3 were carried out as previously described, with some modifications (Lim et al ., 2012; Park et al ., 2014). Briefly, Escherichia coli DH5α cells transformed with pCW (CYP158A3) and pGroEL/ES vectors were inoculated in Luria-Bertani (LB) broth containing 50 μg/mL ampicillin and 20 μg/mL kanamycin; cells were then pre-cultured overnight at 37°C.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Characterization of a Biflaviolin Synthase CYP158A3 from Streptomyces avermitilis and Its Role in the Biosynthesis of Secondary Metabolites

Lim

Han

Kim

et al. 2016

Biomol Ther (Seoul)

Self Cite

View full text Add to dashboard Cite

Streptomyces avermitilis produces clinically useful drugs such as avermectins and oligomycins. Its genome contains approximately 33 cytochrome P450 genes and they seem to play important roles in the biosynthesis of many secondary metabolites. The SAV_7130 gene from S. avermitilis encodes CYP158A3. The amino acid sequence of this enzyme has high similarity with that of CYP158A2, a biflaviolin synthase from S. coelicolor A3(2). Recombinant S. avermitilis CYP158A3 was heterologously expressed and purified. It exhibited the typical P450 Soret peak at 447 nm in the reduced CO-bound form. Type I binding spectral changes were observed when CYP158A3 was titrated with myristic acid; however, no oxidative product was formed. An analog of flaviolin, 2-hydroxynaphthoquinone (2-OH NQ) displayed similar type I binding upon titration with purified CYP158A3. It underwent an enzymatic reaction forming dimerized product. A homology model of CYP158A3 was superimposed with the structure of CYP158A2, and the majority of structural elements aligned. These results suggest that CYP158A3 might be an orthologue of biflaviolin synthase, catalyzing C-C coupling reactions during pigment biosynthesis in S. avermitilis.

show abstract

Crystal structure of cytochrome P450 CYP105N1 from Streptomyces coelicolor, an oxidase in the coelibactin siderophore biosynthetic pathway

Cited by 21 publications

References 31 publications

Structure of OxyA_tei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Structure of OxyA_tei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Beyond iron: non-classical biological functions of bacterial siderophores

Characterization of a Biflaviolin Synthase CYP158A3 from Streptomyces avermitilis and Its Role in the Biosynthesis of Secondary Metabolites

Contact Info

Product

Resources

About

Crystal structure of cytochrome P450 CYP105N1 from Streptomyces coelicolor, an oxidase in the coelibactin siderophore biosynthetic pathway

Cited by 21 publications

References 31 publications

Structure of OxyAtei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Structure of OxyAtei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Beyond iron: non-classical biological functions of bacterial siderophores

Characterization of a Biflaviolin Synthase CYP158A3 from Streptomyces avermitilis and Its Role in the Biosynthesis of Secondary Metabolites

Contact Info

Product

Resources

About

Structure of OxyA_tei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade

Structure of OxyA_tei: completing our picture of the glycopeptide antibiotic producing Cytochrome P450 cascade