Crystal structure and activity profiling of deubiquitinating inhibitors-bound to SARS-CoV-2 papain like protease revealed new allosteric sites for antiviral therapies

Abstract

Emerging variants of SARS-CoV-2 still threaten the effectiveness of currently deployed vaccines, and antivirals can prove to be an effective therapeutic option for attenuating it. The papain-like protease (PLpro) is an attractive target due to its sequence conservation and critical role in the replication and pathogenesis of SARS-CoV-2. PLpro also plays very important role in modulation of host immune responses by deubiquitinating (DUBs) or deISGylating host proteins. Thus, targeting PLpro serves as a two-pronged approach to abate SARS-CoV-2. Due to its structural and functional similarities with the host DUB enzymes, an in-house library of DUB inhibitors was constituted in this study. Five promising compounds exhibiting high binding affinities with the substrate binding site of PLpro were identified from a library of 81 compounds with in silico screening, docking, and simulation studies. Interestingly, lithocholic acid, linagliptin, teneligliptin, and flupenthixol significantly inhibited the proteolytic activity of PLpro. Each of these compounds abrogated in vitro replication of SARS-CoV-2 with EC50 values in the range of 5-21 micro M. In addition, crystal structure of SARS-CoV-2 PLpro and its complex with inhibitors have been determined that revealed their inhibitory mechanism. The findings of this study provide the proof-of-principle that the DUB inhibitors hold high potential as a new class of therapeutics against SARS-CoV-2. Additionally, this is the first study that has opened a new avenue towards not only targeting PLpro active site but also simultaneously directing towards restoration of antiviral immune response of the host for deterring SARS-CoV-2.

Unraveling antiviral efficacy of multifunctional immunomodulatory triterpenoids against SARS‐COV‐2 targeting main protease and papain‐like protease

“…After restriction digestion, the gene was subcloned into NcoI and XhoI restriction sites in pET28c vector with an N‐terminal histidine tag. Codon‐optimized gene encoding the full‐length SARS‐CoV‐2 PLpro (1–315 amino acids) was custom synthesized (Invitrogen, Thermo Fisher Scientific) and was cloned using XhoI and NdeI restriction sites in pET28c vector containing an N‐terminal 6X histidine tag, using 5′‐CAGCCATATGGAAGTTCGTACCATTAAAGT TTTTAC‐3′ forward primer and 5′‐GGTGCTCGAGCTATTTGATGGTGGTG‐3′ reverse primer, as described previously 52 . The recombinant constructs for PLpro and Mpro were transformed into competent E. coli Rosetta cells at 37 °C in Luria Broth (LB) containing 35 μg/mL chloramphenicol and 50 μg/mL of kanamycin until the optical density (O.D.)…”

“…The production of infectious virus in compound‐treated cells and SARS‐CoV‐2‐infected cells in comparison to only infected cells was quantified by tissue culture infectious dose 50 (TCID 50 ) assay as reported previously 52 . Vero cells were plated at a density of 1 × 10 4 cells/well in a 96‐well plate and the plate was incubated overnight at 37 °C in a 5% CO 2 incubator to reach 80%–90% confluency.…”

“…The production of infectious virus in compound-treated cells and SARS-CoV-2-infected cells in comparison to only infected cells was quantified by tissue culture infectious dose 50 (TCID 50 ) assay as reported previously. 52 Vero cells were plated at a density of 1 Â 10 4 cells/well in a 96-well plate and the plate was incubated overnight at 37 C in a 5% CO 2 incubator to reach 80%-90% confluency. The cellular monolayer was then exposed to 10-fold serial dilutions (10 1 to 10 8 ) of freeze-thawed lysate of cells infected and treated with compounds, collected at 48 h postinfection of the antiviral assay.…”