Cryptic prokaryotic promoters explain instability of recombinant neuronal sodium channels in bacteria

Abstract

Mutations in genes encoding the human-brain-expressed voltage-gated sodium (Na V ) channels Na V 1.1, Na V 1.2, and Na V 1.6 are associated with a variety of human diseases including epilepsy, autism spectrum disorder, familial migraine, and other neurodevelopmental disorders. A major obstacle hindering investigations of the functional consequences of brain Na V channel mutations is an unexplained instability of the corresponding recombinant complementary DNA (cDNA) when propagated in commonly used bacterial strains manifested by high spontaneous rates of mutation. Here, using a combination of in silico analysis, random and site-directed mutagenesis, we investigated the cause for instability of human Na V 1.1 cDNA. We identified nucleotide sequences within the Na V 1.1 coding region that resemble prokaryotic promoter-like elements, which are presumed to drive transcription of translationally toxic mRNAs in bacteria as the cause of the instability. We further demonstrated that mutations disrupting these elements mitigate the instability. Extending these observations, we generated full-length human Na V 1.1, Na V 1.2, and Na V 1.6 plasmids using one or two introns that interrupt the latent reading frames along with a minimum number of silent nucleotide changes that achieved stable propagation in bacteria. Expression of the stabilized sequences in cultured mammalian cells resulted in functional Na V channels with properties that matched their parental constructs. Our findings explain a widely observed instability of recombinant neuronal human Na V channels, and we describe re-engineered plasmids that attenuate this problem.

Enhanced slow inactivation contributes to dysfunction of a recurrent SCN2A mutation associated with developmental and epileptic encephalopathy

“…2020; DeKeyser et al . 2021). Site directed mutagenesis was performed using the QuikChange system (Agilent, Inc., Santa Clara, CA, USA) and a mutagenic oligonucleotide primer pair with sequences 5’‐GTTCTCCGATCATTCCAGCTGCTCCGAGTTTTC‐3’ (forward) and 5’‐GAAAACTCGGAGCAGCTGGAATGATCGGAGAAC‐3’ (reverse).…”

Epilepsy-associatedSCN2A(NaV1.2) Variants Exhibit Diverse and Complex Functional Properties

“…Full-length cDNAs encoding WT or variant intron-stabilized human Na V 1.2 corresponding to both adult (NCBI accession NM_021007) and neonatal (NCBI accession NM_001371246) splice isoforms (14, 15) were engineered into vectors in which we introduced a high efficiency encephalomyocarditis virus internal ribosome entry site (IRES) with A6 bifurcation sequence (16) followed by the monomeric red fluorescent protein mScarlet (pIRES2-mScarlet).…”

“…Variants were introduced into Na V 1.2 by site-directed mutagenesis using Q5 2X high-fidelity DNA polymerase Master Mix (New England Biolabs, Ipswich, MA) as previously described (15). Mutagenic primers were designed using custom software (available upon request) and are presented in Table S1 .…”

Genetic therapeutic advancements for Dravet Syndrome

“…Several types of viral vectors are available for gene therapy applications, each offering their own advantages and disadvantages, examples of which can be found in Table 1. The use of lentiviral vectors for DS has been limited due to the unstable nature of the SCN1A coding sequence in bacteria [55], rendering amplification of this gene for viral vector packaging significantly more challenging. Therefore, here we will primarily discuss the uses of Adeno-associated virus (AAV) and adenoviral vectors, as they are the most relevant in the DS field.…”