CRISPR Content Correlates with the Pathogenic Potential of Escherichia coli

Abstract

Guide RNA molecules (crRNA) produced from clustered regularly interspaced short palindromic repeat (CRISPR) arrays, altogether with effector proteins (Cas) encoded by cognate cas (CRISPR associated) genes, mount an interference mechanism (CRISPR-Cas) that limits acquisition of foreign DNA in Bacteria and Archaea. The specificity of this action is provided by the repeat intervening spacer carried in the crRNA, which upon hybridization with complementary sequences enables their degradation by a Cas endonuclease. Moreover, CRISPR arrays are dynamic landscapes that may gain new spacers from infecting elements or lose them for example during genome replication. Thus, the spacer content of a strain determines the diversity of sequences that can be targeted by the corresponding CRISPR-Cas system reflecting its functionality. Most Escherichia coli strains possess either type I-E or I-F CRISPR-Cas systems. To evaluate their impact on the pathogenicity of the species, we inferred the pathotype and pathogenic potential of 126 strains of this and other closely related species and analyzed their repeat content. Our results revealed a negative correlation between the number of I-E CRISPR units in this system and the presence of pathogenicity traits: the median number of repeats was 2.5-fold higher for commensal isolates (with 29.5 units, range 0–53) than for pathogenic ones (12.0, range 0–42). Moreover, the higher the number of virulence factors within a strain, the lower the repeat content. Additionally, pathogenic strains of distinct ecological niches (i.e., intestinal or extraintestinal) differ in repeat counts. Altogether, these findings support an evolutionary connection between CRISPR and pathogenicity in E. coli.

Incidence of Type II CRISPR1-Cas Systems in Enterococcus Is Species-Dependent

“…sulfureus in human disease could not be found in scientific literature. The rarity with which these species are pathogenic suggests an inverse correlation between virulence and CRISPR content, as was demonstrated in Escherichia coli [ 15 , 38 , 39 ]. Accurate frequencies of CRISPR1 loci in these species will require more comprehensive testing.…”

Complete Genome Sequence of the Human Gut Symbiont Roseburia hominis

“…The CRISPR-Cas system in this bacterium includes a 33-bp consensus direct repeat GTCGCTCCCTGTGAGGGGAGCGTGGATTGAAAT with 82 spacers, with a total length of 6,582 bp. The large number of spacers found maybe due to its symbiotic nature: there is a negative correlation between the number of repeats and pathogenic potential ( 8 , 9 ). CRISPR-Cas acts as a barrier against the gene influx including virulence genes.…”

Discovery of Escherichia coli CRISPR sequences in an undergraduate laboratory

“…Although some strains shared CRISPR spacers, most strains had a unique combination of spacers. Diversity in E. coli CRISPR repeat number and spacer sequences has been observed in several subsequent studies as well [17][18][19][20].…”

“…Although the iap CRISPR system in E. coli K-12 is relatively well characterized, CRISPR systems in field strains (non-laboratory strains) are highly diverse with respect to spacer number and spacer sequences [10,[17][18][19][20]. In an important article that was the inspiration for the design of this laboratory, Diez-Villasenor et al analyzed the ECOR E. coli strain collection for the presence of the iap CRISPR locus [10].…”