CRISPR/Cas9 Methodology for the Generation of Knockout Deletions in Caenorhabditis elegans

Abstract

The Caenorhabditis elegans Gene Knockout Consortium is tasked with obtaining null mutations in each of the more than 20,000 open reading frames (ORFs) of this organism. To date, approximately 15,000 ORFs have associated putative null alleles. As there has been substantial success in using CRISPR/Cas9 in C. elegans, this appears to be the most promising technique to complete the task. To enhance the efficiency of using CRISPR/Cas9 to generate gene deletions in C. elegans we provide a web-based interface to access our database of guide RNAs (http://genome.sfu.ca/crispr). When coupled with previously developed selection vectors, optimization for homology arm length, and the use of purified Cas9 protein, we demonstrate a robust and effective protocol for generating deletions for this large-scale project. Debate and speculation in the larger scientific community concerning off-target effects due to non-specific Cas9 cutting has prompted us to investigate through whole genome sequencing the occurrence of single nucleotide variants and indels accompanying targeted deletions. We did not detect any off-site variants above the natural spontaneous mutation rate and therefore conclude that this modified protocol does not generate off-target events to any significant degree in C. elegans. We did, however, observe a number of non-specific alterations at the target site itself following the Cas9-induced double-strand break and offer a protocol for best practice quality control for such events.

Working with Worms: Caenorhabditis elegans as a Model Organism

“…Various protocols now incorporate variations, including injection of the Cas9 protein and/or purified sgRNA (Kim & Colaiácovo, ). Innovations and adaptations of CRISPR/Cas9 technologies comprise the inclusion of LoxP/Cre sites on recombination templates (to allow removal of selection markers from established knock‐in/out lines) and the SapTrap system derived from GoldenGate cloning, which provides a simple way to make a variety of knock‐in/out repair constructs (Au et al., ; Schwartz & Jorgensen, ). CRISPR interference and CRISPR activation (CRISPRi and CRISPRa, respectively) have also been successful in C. elegans (Long et al., ; Savell et al., ).…”

Characterisation of protein isoforms encoded by theDrosophilaGlycogen Synthase Kinase 3 geneshaggy

“…We used CRISPR-Cas9 genome engineering to generate in locus deletions to remove the C-terminal exons specific for the Sgg-PA or Sgg-PB proteoform families. We completely removed the unique exons, replacing them with a 3Px3 driven DsRED marker, flanked by LoxP sites, that was subsequently removed by the activity of Cre recombinase to leave the remainder of the locus largely unaltered [44].…”

Systematic phenomics analysis of ASD-associated genes reveals shared functions and parallel networks underlying reversible impairments in habituation learning

“…168 The Moerman lab guide selection tool (http://genome.sfu.ca/crispr/) was used to identify the nlg-1 targeting sgRNA. 53 The nlg-1 sgRNA sequence: TCACCAACGTGTCCACGTCA was cloned into the pU6::klp-12 sgRNA vector (obtained from Calarco lab) using site-directed mutagenesis and used for all editing experiments. The nlg-1::AID::GFP::nlg-1 upstream and nlg-1 3' UTR downstream homology arms were synthesized by IDT and cloned into the loxP_myo2_neoR repair construct (obtained from Calarco lab) using Gibson Assembly.…”

“…Further, CRISPR-Cas9 genome engineering has proven to be reliable and efficient in C. elegans, and unlike most organisms analyzed to date, multiple rigorous whole-genome sequencing studies have revealed no evidence of significant off-target effects due to CRISPR-Cas9 genome editing in this organism. 44,[53][54][55][56][57][58][59] Finally, we developed the Multi-Worm Tracker (MWT), a machine vision system that allows for comprehensive phenotypic analysis of large populations of freely behaving animals while they perform complex sensory and learning behaviors. 60,61 Multiplexing by running several trackers in parallel allows for analysis of multiple measures of morphology, locomotion, mechanosensory sensitivity, as well as several forms of learning in hundreds of animals simultaneously.…”