Crepis foetida L.: New host plant of cixiid planthopper Hyalesthes obsoletus Signoret 1865 (Hemiptera: Cixiidae), vector of stolbur phytoplasma

Kosovac, Andrea; Jakovljević, Miljana; Krstić, Oliver; Cvrković, Tatjana; Mitrović, Milana; Toševski, Ivo; Jović, Jelena

doi:10.5937/zasbilj1401007k

Cited by 7 publications

(3 citation statements)

References 5 publications

(9 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although CaPsol-induced plant diseases have, in certain instances, been linked to vectors associated with crop plants [ 10 , 11 ], multiple reports highlight that HobsCa populations, associated with a non-crop plant, are the main contributors to CaPsol tuf-b type outbreaks in Serbia [ 15 , 18 ]. HobsCa completes its life cycle on C. arvensis plants present within arable land, while CaPsol-infected HobsCa populations have also been found on C. arvensis in ruderal and undisturbed habitats [ 36 ]. The results from the obtained transmission tests indicated the ability of HobsCa to introduce CaPsol infections into maize fields.…”

Section: Discussionmentioning

confidence: 99%

Plants under Siege: Investigating the Relevance of ‘Ca. P. solani’ Cixiid Vectors through a Multi-Test Study

Kosovac,

Rekanović,

Ćurčić

et al. 2023

Plants

Self Cite

View full text Add to dashboard Cite

Crop losses caused by the plant pathogenic bacterium ‘Candidatus Phytoplasma solani’ (CaPsol) underscore the need to better understand its perplexing epidemiological pathways. Hyalesthes obsoletus (Hemiptera, Cixiidae) is a prominent CaPsol vector with three plant associations in Serbia (ex Urtica dioica/HobsUd; ex Convolvulus arvensis/HobsCa; ex Crepis foetida/HobsCf). Another cixiid planthopper, Reptalus quinquecostatus (Dufour), has been recently confirmed as a noteworthy CaPsol vector. A multi-test study assessed the relevance of H. obsoletus associations and R. quinquecostatus populations from Crataegus monogyna and Prunus spinosa in CaPsol occurrence in sugar beet, maize, and tobacco. Molecular typing of the CaPsol strains transmitted to test plants in experimental trials provided the first evidence of HobsUd transmitting CaPsol tuf-a type to sugar beet, HobsCa infecting maize and tobacco with tuf-b type, and HobsCf transmitting CaPsol tuf-b to maize. Affiliation of R. quinquecostatus with the specific CaPsol genotype, dSTOLg, was reaffirmed in this study. The possible involvement of R. quinquecostatus in maize redness disease and tobacco stolbur was suggested, given that this cixiid was identified as a vector of CaPsol to these crops. The obtained results indicate that the tested vectors pose a threat to cultivated plants in Serbia, underscoring the need to recognize their relevance in CaPsol disease occurrences.

show abstract

Section: Discussionmentioning

confidence: 99%

Plants under Siege: Investigating the Relevance of ‘Ca. P. solani’ Cixiid Vectors through a Multi-Test Study

Kosovac,

Rekanović,

Ćurčić

et al. 2023

Plants

Self Cite

View full text Add to dashboard Cite

show abstract

“…In addition to 16S rDNA, the tuf and stamp gene sequences were analyzed in selected samples. The tuf gene was amplified using the Tuf1-f1/r1 primer pair, followed by fTufAy/rTufAy in nested PCR assays [ 9 , 18 , 19 ] https://apsjournals.apsnet.org/doi/10.1094/PDIS-07-20-1602-RE - b44 . For amplification of the stamp gene, nested PCR assays were conducted using the Stamp-F/R0 primer pair, followed by Stamp-F1/R1 [ 20 ].…”

Section: Methodsmentioning

confidence: 99%

Geographical variations, prevalence, and molecular dynamics of fastidious phloem-limited pathogens infecting sugar beet across Central Europe

Duduk,

Stepanović,

Fránová

et al. 2024

PLoS ONE

View full text Add to dashboard Cite

In Europe, two fastidious phloem-limited pathogens, ’Candidatus Phytoplasma solani’ (16SrXII-A) and ’Candidatus Arsenophonus phytopathogenicus’, are associated with rubbery taproot disease (RTD) and syndrome basses richesses (SBR) of sugar beet, respectively. Both diseases can significantly reduce yield, especially when accompanied by root rot fungi. This study investigates the presence, geographic distribution and genetic traits of fastidious pathogens and the accompanying fungus, Macrophomina phaseolina, found on sugar beet across four geographically separated plains spanning seven countries in Central Europe. The survey revealed variable incidences of symptoms linked to these fastidious pathogens in the Pannonian and Wallachian Plains, sporadic occurrence in the North European Plain, and no symptomatic sugar beet in the Bohemian Plain. Molecular analyses unveiled the occurrence of both ’Ca. P. solani’ and ’Ca. A. phytopathogenicus’ throughout Central Europe, with a predominance of the phytoplasma. These fastidious pathogens were detected in all six countries surveyed within the Pannonian and Wallachian Plains, with only a limited presence of various phytoplasmas was found in the North European Plain, while no fastidious pathogens were detected in Bohemia, aligning with observed symptoms. While 16S rDNA sequences of ’Ca. P. solani’ remained highly conserved, multi-locus characterization of two more variable loci (tuf and stamp) unveiled distinct variability patterns across the plains. Notably, the surprising lack of variability of tuf and stamp loci within Central Europe, particularly the Pannonian Plain, contrasted their high variability in Eastern and Western Europe, corresponding to epidemic and sporadic occurrence, respectively. The current study provides valuable insights into the genetic dynamics of ’Ca. P. solani’ in Central Europe, and novel findings of the presence of ’Ca. A. phytopathogenicus’ in five countries (Slovakia, Czech Republic, Austria, Serbia, and Romania) and M. phaseolina in sugar beet in Slovakia. These findings emphasize the need for further investigation of vector–pathogen(s)–plant host interactions and ecological drivers of disease outbreaks.

show abstract

“…P. solani’-positive samples were further subjected to characterization of the epidemiologically decisive tuf gene that indicates strains affiliation to a specific epidemiological cycle ( Langer and Maixner, 2004 ; Aryan et al, 2014 ; Ćurčić et al, 2021b ). To amplify the tuf gene, the Tuf1-f1/Tuf1-r1 (CACGTTGATCACGGCAAAAC/CCACCTTCACGGATAGAAAAC) and fTufAy/rTufAy primer pairs were used in nested PCR assays ( Schneider and Gibb, 1997 ; Langer and Maixner, 2004 ; Kosovac, 2018 ). For differentiation of the tuf types (tuf-a, b, and d), the obtained tuf amplicons (fTufAy/rTufAy) were subjected to RFLP analyses with Hpa II and Tai I restriction enzymes (Thermo Scientific) in separate reactions, according to manufacturer’s instructions ( Langer and Maixner, 2004 ; Ćurčić et al, 2021b ).…”

Section: Methodsmentioning

confidence: 99%

A biotroph sets the stage for a necrotroph to play: ‘Candidatus Phytoplasma solani’ infection of sugar beet facilitated Macrophomina phaseolina root rot

et al. 2023

Self Cite

View full text Add to dashboard Cite

‘Candidatus Phytoplasma solani’ (stolbur phytoplasma) is associated with rubbery taproot disease (RTD) of sugar beet (Beta vulgaris L.), while Macrophomina phaseolina is considered the most important root rot pathogen of this plant in Serbia. The high prevalence of M. phaseolina root rot reported on sugar beet in Serbia, unmatched elsewhere in the world, coupled with the notorious tendency of RTD-affected sugar beet to rot, has prompted research into the relationship between the two diseases. This study investigates the correlation between the occurrence of sugar beet RTD and the presence of root rot fungal pathogens in a semi-field ‘Ca. P. solani’ transmission experiment with the cixiid vector Reptalus quinquecostatus (Dufour), in addition to naturally infected sugar beet in the open field. Our results showed that: (i) Reptalus quinquecostatus transmitted ‘Ca. P. solani’ to sugar beet which induced typical RTD root symptoms; (ii) Macrophomina phaseolina root rot was exclusively present in ‘Ca. P. solani’-infected sugar beet in both the semi-field experiment and naturally infected sugar beet; and that (iii) even under environmental conditions favorable to the pathogen, M. phaseolina did not infect sugar beet, unless the plants had been previously infected with phytoplasma.

show abstract

Crepis foetida L.: New host plant of cixiid planthopper Hyalesthes obsoletus Signoret 1865 (Hemiptera: Cixiidae), vector of stolbur phytoplasma

Cited by 7 publications

References 5 publications

Plants under Siege: Investigating the Relevance of ‘Ca. P. solani’ Cixiid Vectors through a Multi-Test Study

Plants under Siege: Investigating the Relevance of ‘Ca. P. solani’ Cixiid Vectors through a Multi-Test Study

Geographical variations, prevalence, and molecular dynamics of fastidious phloem-limited pathogens infecting sugar beet across Central Europe

A biotroph sets the stage for a necrotroph to play: ‘Candidatus Phytoplasma solani’ infection of sugar beet facilitated Macrophomina phaseolina root rot

Contact Info

Product

Resources

About