Correction to Terminating DNA Tile Assembly with Nanostructured Caps

Abstract

Metrics & MoreArticle RecommendationsI n Supporting Information, on page 9, the sequences of the two RT A seed adapter strands, "A-4bp-5_6REd_2: TGGTTGCTCGTGCTTGGCTGGCAT" and "A-4bp-9_10SRd_2: TGGTTGCTCGTGCTTGGCTGGCAT", are incorrect.These two sequences should be replaced with "A-4bp-5_6REd_2: TGGTTCGTCCGCTGGCTCTGGCAT" and "A-4bp-9_10SRd_2: TGGTTCAGGCTTGACGGTTGG-CAT". This erratum does not affect any of the experimental results, discussions, or conclusions reported in the paper. The authors sincerely apologize for this oversight.