Coronaviruses from pheasants ( Phasianus colchicus ) are genetically closely related to coronaviruses of domestic fowl (infectious bronchitis virus) and turkeys

Abstract

Reverse-transcriptase polymerase chain reactions (RT-PCRs) were used to examine RNA extracted from mouth/nasal swabs from pheasants exhibiting signs of respiratory disease. The oligonucleotides used were based on sequences of infectious bronchitis virus (IBV), the coronavirus of domestic fowl. A RT-PCR for the highly conserved region II of the 3' untranslated region of the IBV genome detected a coronavirus in swabs from 18/21 estates. Sequence identity with the corresponding region of IBVs and coronaviruses from turkeys was > 95%. A RT-PCR for part of the S1 region of the spike protein gene was positive with 13/21 of the samples. Sequence analysis of the RT-PCR products derived from nine of the pheasant viruses revealed that some of the viruses differed from each other by approximately 24%, similar to the degree of difference exhibited by different serotypes of IBV. Further analysis of the genome of one of the viruses revealed that it contained genes 3 and 5 that are typical of IBV but absent in both the transmissible gastroenteritis virus and murine hepatitis virus groups of mammalian coronaviruses. The nucleotide sequences of genes 3 and 5 of the pheasant virus had a similar degree of identity (approximately 90%) with those of coronaviruses from turkeys and chickens, as is observed when different serotypes of IBV are compared. This work: (a) confirms that coronaviruses are present in pheasants (indeed, commonly present in pheasants with respiratory disease); (b) demonstrates that their genomes are IBV-like in their organization; and (c) shows that there is sequence heterogeneity within the group of pheasant coronaviruses, especially within the spike protein gene. Furthermore, the gene sequences of the pheasant viruses differed from those of IBV to similar extents as the sequence of one serotype of IBV differs from another. On the genetic evidence to date, there is a remarkably high degree of genetic similarity between the coronaviruses of chickens, turkeys and pheasants.

Isolation of avian infectious bronchitis coronavirus from domestic peafowl (Pavo cristatus) and teal (Anas)

“…The gene order of IBV is 59-replicase-S-3-M-5-N-39 UTR. We have established in this study that both pf/CH/LKQ3/03 and tl/CH/LDT3/03 have the same S-3-M-5-N gene order (the replicase and 39 UTR sequences were not determined in this study), as is the case for coronaviruses from turkeys (Breslin et al, 1999a, b;Cavanagh et al, 2001) and pheasant (Cavanagh et al, 2002). Consequently, the coronaviruses from domestic peafowl and teal are related closely to avian coronaviruses that are in group 3, and are distinct from mammalian coronaviruses that are in groups 1 and 2 (Lai & Cavanagh, 1997 tl/CH/LDT3/03, in contrast to pf/CH/LKQ3/03, was more similar to field IBV isolates from China than to the vaccine strains.…”

“…Sequence analysis of these clones revealed that both newly isolated avian coronaviruses had the S-3-M-5-N gene order that is typical of group 3 coronaviruses from chicken (IBV) (Boursnell et al, 1987), turkey (Breslin et al, 1999a;Cavanagh et al, 2001;Lin et al, 2002) and pheasant (Cavanagh et al, 2002).…”

Typing infectious bronchitis virus strains using reverse transcription-polymerase chain reaction and restriction fragment length polymorphism analysis to compare the 3′ 7.5 kb of their genomes

“…For the amplification reaction, two primers, XCE1'/ (ACTGGTAATTTTTCAGATGG) and UTR11 Á/ (GCTCTAACTCTATACTAGCCTA) (Cavanagh et al , 2002), binding within the S1 gene and the 3?-untranslated region (UTR) of the genome, respectively, were initially used to amplify a fragment of approximately 6.5 kb of the IBV genome. However these primers were unable to amplify 6.5 kb fragments from a number of IBV strains, including N1/ 88 and N1/03.…”

Innovation and discovery: The application of nucleic acid-based technology to avian virus detection and characterization

“…This is also the case for a recently analyzed coronavirus from turkeys in Britain , the first demonstration of a coronavirus in turkeys beyond North America. Furthermore, viruses associated with respiratory and kidney disease in pheasants have been discovered to be very similar to IBVs (Cavanagh et al, 2002). The use of general oligonucleotides, based on the many IBV sequences available, in RT-PCRs has played an important part in the characterization of these coronaviruses.…”

“…the 'XCE' oligonucleotides in epidemiological studies of broilers in the UK, Italy and Poland (Capua et al, 1999;Cavanagh et al, 1999), and for characterization of coronaviruses in pheasants (Cavanagh et al, 2002). Although the use of the general primers with pheasant viruses illustrates their wide applicability, they are not universal; some types of IBV differ too much, e.g.…”