Core promoter elements are essential as selective determinants for function of the yeast transcription factor GAL11

Sakurai, Hiroshi; Ohishi, Tomoko; Fukasawa, Toshio

doi:10.1016/s0014-5793(96)01219-7

Cited by 15 publications

(22 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We previously suggested that GAL11 is required for maximal transcription of various genes containing the TATA box (27). Here we have shown that transcription from TATA-containing 5), TFIIE-⌬C (lanes 2 and 3), and Gal11 (lanes 3 and 5) were added to the indicated reaction mixtures.…”

Section: Discussionmentioning

confidence: 77%

“…Rich glucose (YPD), enriched synthetic, synthetic complete, and 5-fluoroorotic acid-containing media were prepared as described (24,27,28). Galactose utilization of cells was assayed using EBGal medium (18).…”

Section: Methodsmentioning

confidence: 99%

“…Primer Extension Analysis-Total RNA was isolated as described (27,32) and quantified by the absorbance at 260 nm. The integrity of the RNA sample was confirmed by methylene blue staining after agarose gel electrophoresis.…”

mentioning

confidence: 99%

“…The integrity of the RNA sample was confirmed by methylene blue staining after agarose gel electrophoresis. Primer extension analysis was carried out with specific primers for the ACT1, CYH2, GAL4, GAL80, and MF␣1 genes as described (27,32). The nucleotide sequences of primers for CTS1 and HIS4 are TGAGTTTTGACCCCAATAAACAGC and TCCTTCTTAC-TATTCCATGAGGCC, respectively.…”

mentioning

confidence: 99%

See 3 more Smart Citations

Yeast Gal11 and Transcription Factor IIE Function through a Common Pathway in Transcriptional Regulation

Sakurai

Fukasawa

1997

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

The global transcription regulator Gal11, a component of RNA polymerase II holoenzyme, is required for full expression of many genes in yeast. We previously reported that Gal11 binds the small (Tfa2) and large (Tfa1) subunits of the general transcription factor (TF) IIE through Gal11 functional domains A and B, respectively. Here we demonstrate that the C-terminal basic region in Tfa2 is responsible for binding to domain A, whereas both the N-terminal hydrophobic and internal glutamic acid-rich regions in Tfa1 are responsible for binding to domain B. Yeast cells bearing a C-terminal deletion encompassing the Gal11-interacting region in each of the two TFIIE subunits, being viable, exhibited no obvious phenotype. In contrast, combination of the two deletions (TFIIE-⌬C) showed phenotypes similar to those of gal11 null mutations. The levels of mRNA from TATA-containing genes, but not from TATA-less genes, decreased in TFIIE-⌬C to an extent comparable to that in the gal11 null mutant. Combination of TFIIE-⌬C with a gal11 null mutation did not result in an enhanced effect, suggesting that both TFIIE and Gal11 act in a common regulatory pathway. In a reconstituted cellfree system, Gal11 protein stimulated basal transcription in the presence of wild-type TFIIE. Such a stimulation was not seen in the presence of TFIIE-⌬C.

show abstract

Section: Discussionmentioning

confidence: 77%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Yeast Gal11 and Transcription Factor IIE Function through a Common Pathway in Transcriptional Regulation

Sakurai

Fukasawa

1997

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Alternatively, the mediator complex, a component of the RNA-polymerase II holoenzyme, which is indispensable for regulated gene expression, might serve as coactivator (40,41). For instance, Gal11p, a component of the mediator, is essential for regulated expression of GAL80, but not required for initiator-dependent constitutive transcription of this gene (42). The mechanism that distinguishes between TATA-containing and TATA-less promoters remains to be elucidated.…”

Section: Inversion Of the Intergenic Region Between Gcy1 And Rio1-mentioning

confidence: 99%

The Type of Basal Promoter Determines the Regulated or Constitutive Mode of Transcription in the Common Control Region of the Yeast Gene Pair GCY1/RIO1

Angermayr

Bandlow

1997

Journal of Biological Chemistry

View full text Add to dashboard Cite

The yeast genes, GCY1 and RIO1, are transcribed divergently from the 869-base pair intergenic region. GCY1 is inducible by galactose about 25-fold due to Gal4p-binding to a single UAS GAL , whereas RIO1 is constitutively expressed. GCY1 has a TATA box obeying the consensus TATAAA, whereas the RIO1 5-upstream region lacks such a motif. In vitro mutagenesis of the TATA motif of GCY1, on the one hand, and introduction of a TATA-element into the promoter of RIO1, on the other hand, as well as inversion of the intergenic region have revealed that transcription of GCY1 and RIO1 is only regulated by Gal4p when a consensus TATA motif is included in their core promoters but not in its absence. The data imply that only transcription complexes that assemble at a consensus TATA box are compatible with specific transactivators, such as Gal4p. As a result, the adjacent gene is subject to regulated expression. By contrast, if a consensus TATA sequence is absent, the initiation complex does not respond to regulatory transcription factors, and consequently, the respective gene is constitutively transcribed. On the other hand, we show that two blocks of homo-oligomeric (dA⅐dT) sequences do not function as boundary sequences that might confine regulatory action of Gal4p to GCY1.The yeast genome is densely packed with genetic information, and consequently, distances between two genes are relatively short. Frequently, adjacent genes are transcribed divergently from the same intergenic control region. In some cases, the mode of their expression differs, e.g. one gene is expressed in a regulated fashion, whereas the other one is constitutively transcribed. One such example is HIS3 and PET56; HIS3 is induced by a shortage of amino acids, whereas expression of PET56 is unregulated (1). TATA boxes and initiator elements are targets of basal transcription factors (reviewed in Ref. 2). These elements are sufficient for basal transcription. However, specific transactivators, which bind to cis-acting upstream elements, are required for regulated gene expression (reviewed in Ref.3). Regulatory transcription factors act in both orientations and at long distances. Therefore, it seems to be contradictory that transactivator-binding to an intergenic region exclusively influences expression of one gene, whereas the divergently transcribed gene is constitutively expressed. The maintenance of individual gene expression is controversially discussed. Analyses of the HIS3 promoter resulted in the hypothesis that two distinct types of TATA boxes exist: constitutive elements that assemble the basal initiation complex independent of upstream-binding transactivators, and regulatory TATA motifs following the consensus "TATAAA" that are responsive to upstream regulatory elements (4, 5). It was proposed that there are several TATA-binding proteins that associate with either type of TATA motif (4, 6, 7). A heterogeneity of TATA-binding proteins could not yet be found in yeast, and it has been shown that TBP binds to both types of TATAelements (8, 9). However, ...

show abstract

Transcription Initiation Mediated by Initiator Binding Protein inSaccharomyces cerevisiae

Ohishi-Shofuda

Suzuki

Yano

et al. 1999

Biochemical and Biophysical Research Communications

View full text Add to dashboard Cite

Core promoter elements are essential as selective determinants for function of the yeast transcription factor GAL11

Cited by 15 publications

References 51 publications

Yeast Gal11 and Transcription Factor IIE Function through a Common Pathway in Transcriptional Regulation

Yeast Gal11 and Transcription Factor IIE Function through a Common Pathway in Transcriptional Regulation

The Type of Basal Promoter Determines the Regulated or Constitutive Mode of Transcription in the Common Control Region of the Yeast Gene Pair GCY1/RIO1

Transcription Initiation Mediated by Initiator Binding Protein inSaccharomyces cerevisiae

Contact Info

Product

Resources

About