Cordyceps brittlebankisoides, a New Pathogen of Grubs and Its Anamorph, Metarhizium anisopliae var. majus

Liu, Zuo Yi; Liang, Z.; Whalley, A.J.S.; Yao, Yisang; Liu, A.Y.

doi:10.1006/jipa.2001.5039

Cited by 46 publications

(13 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…M. acridum has a strong RIP bias, but RIP is only functional when meiosis is frequent. Cordyceps taii has been described as the sexual type (teleomorph) of Metarhizium taii [7], [85] but the sexual stages of M. acridum (and M. anisopliae ) are unknown. However, both Metarhizium species have a complement of apparently functional genes whose orthologs in N. crassa and A. nidulans are known to be required for meiosis and sexual development (Table S21).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

et al. 2011

View full text Add to dashboard Cite

Metarhizium spp. are being used as environmentally friendly alternatives to chemical insecticides, as model systems for studying insect-fungus interactions, and as a resource of genes for biotechnology. We present a comparative analysis of the genome sequences of the broad-spectrum insect pathogen Metarhizium anisopliae and the acridid-specific M. acridum. Whole-genome analyses indicate that the genome structures of these two species are highly syntenic and suggest that the genus Metarhizium evolved from plant endophytes or pathogens. Both M. anisopliae and M. acridum have a strikingly larger proportion of genes encoding secreted proteins than other fungi, while ∼30% of these have no functionally characterized homologs, suggesting hitherto unsuspected interactions between fungal pathogens and insects. The analysis of transposase genes provided evidence of repeat-induced point mutations occurring in M. acridum but not in M. anisopliae. With the help of pathogen-host interaction gene database, ∼16% of Metarhizium genes were identified that are similar to experimentally verified genes involved in pathogenicity in other fungi, particularly plant pathogens. However, relative to M. acridum, M. anisopliae has evolved with many expanded gene families of proteases, chitinases, cytochrome P450s, polyketide synthases, and nonribosomal peptide synthetases for cuticle-degradation, detoxification, and toxin biosynthesis that may facilitate its ability to adapt to heterogenous environments. Transcriptional analysis of both fungi during early infection processes provided further insights into the genes and pathways involved in infectivity and specificity. Of particular note, M. acridum transcribed distinct G-protein coupled receptors on cuticles from locusts (the natural hosts) and cockroaches, whereas M. anisopliae transcribed the same receptor on both hosts. This study will facilitate the identification of virulence genes and the development of improved biocontrol strains with customized properties.

show abstract

Section: Discussionmentioning

confidence: 99%

“…As the asexual stages (anamorphs) of medicinally valued Cordyceps spp. [7], Metarhizium spp. are prolific producers of enzymes and diverse secondary metabolites with activities against insects, fungi, bacteria, viruses and cancer cells [6], [8], [9].…”

Section: Introductionmentioning

confidence: 99%

Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

et al. 2011

View full text Add to dashboard Cite

show abstract

“…Notes : Based on the data presented by Liu et al. (2001) , the asexual morph M. brittlebankisoides shares similar morphological characters such as shape of phialides and conidia as M. majus, only the conidia are shorter in M. brittlebankisoides (9–10.2 μm) than in M. majus (10–14 μm).…”

Section: Taxonomymentioning

confidence: 99%

“…2019 ). Our ITS phylogeny using the sequence from the type material ( Liu et al. 2001 ) shows M. brittlebankisoides nested with M. candelabrum and M. huainamdangense and not in the M. anisopliae complex ( Supplementary Fig.…”

Section: Taxonomymentioning

confidence: 99%

Revisiting Metarhizium and the description of new species from Thailand

Mongkolsamrit¹,

Khonsanit²,

Thanakitpipattana³

et al. 2020

Studies in Mycology

101

View full text Add to dashboard Cite

Over the last two decades the molecular phylogeny and classification of Metarhizium has been widely studied. Despite these efforts to understand this enigmatic genus, the basal lineages in Metarhizium are still poorly resolved. In this study, a phylogenetic framework is reconstructed for the Clavicipitaceae focusing on Metarhizium through increased taxon-sampling using five genomic loci (SSU, LSU, tef, rpb1, rpb 2) and the barcode marker ITS rDNA. Multi-gene phylogenetic analyses and morphological characterisation of green-spored entomopathogenic Metarhizium isolates from Thailand and soil isolates of M. carneum and M. marquandii reveal their ecological, genetic and species diversity. Nineteen new species are recognised in the Metarhizium clade with narrow host ranges: two new species are found in the M. anisopliae complex – M. clavatum on Coleoptera larvae and M. sulphureum on Lepidoptera larvae; four new species are found in the M. flavoviride complex – M. biotecense and M. fusoideum on brown plant hoppers ( Hemiptera ), M. culicidarum on mosquitoes, M. nornnoi on Lepidoptera larvae; three new species M. megapomponiae, M. cicadae, M. niveum occur on cicadas; five new species M. candelabrum, M. cercopidarum, M. ellipsoideum, M. huainamdangense M. ovoidosporum occur on planthoppers, leafhoppers and froghoppers ( Hemiptera ); one new species M. eburneum on Lepidoptera pupae; and four new species M. phuwiangense, M. purpureum, M. purpureonigrum, M. flavum on Coleoptera . Of these 19 new species, seven produce a sexual morph ( M. clavatum, M. eburneum, M. flavum, M. phuwiangense, M. purpureonigrum, M. purpureum, and M. sulphureum ) and asexual morphs are found in the remaining new species and also in M. sulphureum, M. purpureonigrum and M. purpureum. Metarhizium blattodeae, M. koreanum and M. viridulum are new records for Thailand. An alternative neotype for Metarhizium anisopliae is proposed based on multi-gene and 5′ tef analyses showing that CBS 130.71 from Ukraine is more suitable, being from a much closer geographical location to Metchnikoff’s Metarhizium anisopliae. This isolate is distinct from the neotype of Metarhizium anisopliae var. anisopl...

show abstract

“…Total DNA was extracted using the CTAB method described by Liu et al (2001). We designed the primer pair used to amplify the nuclear ribosomal small subunit (nrSSU) as nrSSU-CoF (TCTCAAAGATTAAGCCATGC) and nrSSU-CoR (TCACCAACGGAGACCTTG).…”

Section: Dna Extraction Pcr and Sequencingmentioning

confidence: 99%

Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China

Wang

Dai

et al. 2015

Mycol Progress

View full text Add to dashboard Cite

A new species, Polycephalomyces agaricus, which is parasitic on Ophiocordyceps sp., a pathogen of melolonthid larvae in southwestern China, is described using morphological and phylogenetic evidence. This species differs morphologically from other species in the genus by its agaric-shaped synnemata, pileus-like slimy masses on short stipes, globose to subglobose α-conidia, and plenty of laterally or apically proliferating phialides. The phylogenetic analyses based on 5-locus (nrSSU, nrLSU, tef-1α, rpb1, and rpb2) data strongly support that this fungus is a distinct species in the genus.

show abstract

Cordyceps brittlebankisoides, a New Pathogen of Grubs and Its Anamorph, Metarhizium anisopliae var. majus

Cited by 46 publications

References 8 publications

Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

Revisiting Metarhizium and the description of new species from Thailand

Polycephalomyces agaricus, a new hyperparasite of Ophiocordyceps sp. infecting melolonthid larvae in southwestern China

Contact Info

Product

Resources

About