Coordination of Cell Signaling, Chromatin Remodeling, Histone Modifications, and Regulator Recruitment in Human Matrix Metalloproteinase 9 Gene Transcription

Abstract

Transcriptional activation of eukaryotic genes depends on the precise and ordered recruitment of activators, chromatin modifiers/remodelers, coactivators, and general transcription factors to the promoters of target genes. Using the human matrix metalloproteinase 9 (MMP-9) gene as a model system, we investigated the sequential assembly and dynamic formation of transcription complexes on a human promoter under the influence of mitogen signaling. We find that, coincident with activation of the MMP-9 gene, activators, chromatin remodeling complexes, and coactivators are recruited to the preassembled MMP-9 promoter in a stepwise and coordinated order, which is dependent on activation of MEK-1/extracellular signal-regulated kinase and NF-B signaling pathways. Conversely, corepressor complexes are released from the MMP-9 promoter after transcriptional activation. Histone modifications shift from repressive to permissive modifications concurrent with activation of the MMP-9 gene. Chromatin remodeling induced by Brg-1 is required for MMP-9 gene transcription, which is concomitant with initiation of transcription. Therefore, coordination of cell signaling, chromatin remodeling, histone modifications, and stepwise recruitment of transcription regulators is critical to precisely regulate MMP-9 gene transcription in a temporally and spatially dependent manner. Given the important role of MMP-9 in both normal development and pathological conditions, understanding MMP-9 gene regulation is of great relevance.Gene transcription in eukaryotic cells is controlled by protein complexes, including general and tissue-specific transcription factors, coregulators, chromatin-remodeling complexes, and complexes responsible for signal-specific histone modifications (26). As eukaryotic DNA is packaged into chromatin, generally a repressive structure for transcriptional activation, transcription in the context of chromatin requires remodeling processes to reconfigure the chromatin, so that activators, coactivators, and general transcription factors (GTFs) have access to promoters of target genes (12). Chromatin remodeling is dependent on either ATP-dependent chromatin-remodelingcomplex-induced structural modifications of nucleosomes or histone acetyltransferase-(HAT) and histone methyltransferase-mediated covalent modifications of the N-terminal tails of core histones (12). The SWI/SNF chromatin-remodeling complex can alter chromatin structure by either shifting nucleosomes along the DNA or twisting DNA to modulate the nucleosome structure (42). Brg-1 and Brm are two ATPase subunits of the SWI/SNF complex. Recruitment of the SWI/ SNF complex to target promoters requires protein-protein interactions through Brg-1 and other transcription regulators, as Brg-1 does not recognize sequence-specific DNA (21).

Helix-Loop-Helix Protein p8, a Transcriptional Regulator Required for Cardiomyocyte Hypertrophy and Cardiac Fibroblast Matrix Metalloprotease Induction

“…6B), indicating that p8 is capable of associating with the mmp9 and mmp13 promoters in different cell types. The induction by TNF of mmp9 and mmp13 is mediated in part by the AP-1 transcription factor (1,24,34,36,38). Consistent with this, we also observed that recombinant p8 associates with chromatin that contains the AP-1 component c-Jun (Fig.…”

“…S5 in the supplemental material). By contrast, induction of mmp9, which does require AP-1 (24), is augmented by p8. Taken together, these findings suggest that p8 is not a sequence-specific DNA binding protein per se, nor does it likely act at cis elements of sequence-specific transcription factors.…”

“…p8 is a nuclear protein (11,13,26), and our ChIP and RNAi studies clearly implicate p8 in the regulation of transcription, especially the transcription of genes such as anf and mmp9, which are induced by AP-1-dependent mechanisms (24,33,36,42). We have shown here that p8 and c-Jun bind to chromatin that contains consensus AP-1 sites in the anf and mmp9 promoters and that this binding precedes the expression of both genes, consistent with the requirement for p8 for expression of anf and mmp9.…”

“…Recombinant p8 was isolated on Ni-nitrilotriacetic acid resin (QIAGEN). Copurified DNA was amplified using the following primers (two primer sets, for the distal and proximal activator protein 1 [AP-1] sites implicated in regulation of mmp9 expression [1,15,24,34,38], dAP-1 and pAP-1, respectively, were used to amplify segments of the cardiac fibroblast mmp9 promoter): dAP-1 mmp9 forward, TGTCCCCTTTACTGCCCTGA; dAP-1 mmp9 reverse, ACTCCAGGCTCTGTCCTCTT; pAP-1 mmp9 forward, TGAC CCCTGAGTCAGCACTT; pAP-1 mmp9 reverse, CTGCCAGAGGCTCATGG TGA; mmp13 forward, CTCAAATTCTACCACAAACC; mmp13 reverse, GA AGGCAGCCAGGACCCCTG. For the anf promoter, the following primers were used: anf forward, GGCCAGAGGTCCACCCACGA; anf reverse, CCAG ACCCTCAGCTGCAAGA.…”

Cited2 modulates TGF-β-mediated upregulation of MMP9

“…The proximal (À73/ À79) AP-1 site (TGAGTCA) is well conserved among human, rat, and mouse MMP9 promoters, and has high sequence homology to the TGF-b responsive elements, TGACTCA and TGAGTTCA, in human MMP13 and rat PAI-1 promoters, respectively (Uria et al, 1998;Guo et al, 2005). Given that both proximal AP-1 and NF-kB cis-elements are essential for mitogeninduced MMP9 upregulation (Ma et al, 2004), proximal AP-1 and NFkB mutants of MMP9 promoter were further tested for TGF-b-mediated response. Matrix metalloproteinase 9 promoter with a specific mutation in Figure 3 Cited2 enhances Smad3/p300-mediated transcription through p300/Cited2/Smad3 interaction.…”