Construction of Streptococcus agalactiae sialic acid mutant and evaluation of its potential as a live attenuated vaccine in Nile tilapia (Oreochromis niloticus)

Abstract

Aims: This study aimed to develop a live attenuated vaccine as an effective approach to prevent streptococcosis in tilapia (Oreochromis niloticus). Methods and results:We eliminated the virulence factor, sialic acid (Sia) encoded by the neuA-D gene cluster from the Group B Streptococcus (Streptococcus agalactiae, GBS) strain WC1535, to construct Sia-deficient S. agalactiae (ΔSia) mutant by homologous recombination. Results showed that the ΔSia mutant had higher adherence to HEp-2 cells and lower resistance to RAW264.7 cell phagocytosis than the wild-type S.agalactiae. The virulence of the ΔSia mutant to tilapia dramatically decreased with no virulence recovery. The relative percent survivals (RPSs) were 50.00% and 54.50% at 30 days when challenged at the wild-type WC1535 doses of 1.0 × 10 7 and 5.0 × 10 7 CFU fish −1 , respectively, via intraperitoneal (IP) injection. The tilapia vaccinated via IP injection with the ΔSia mutant induced strong antibody agglutination titers. The expression of IL-1β, TNFα, MHC-Iα, and MHC-IIβ could be enhanced in the intestine, spleen, and head kidney for tilapia administered with the ΔSia mutant.Conclusions: GBS Sia plays a critical role in adherence to HEp-2 cells and resistance to the immune clearance of RAW264.7 cells. Moreover, the ΔSia mutant is a safe, stable, and immunogenic live attenuated vaccine candidate to protect tilapia against GBS infection. Significance and impact of study:The results offer more evidence of the importance of Sia in GBS and may be instructive in the control of tilapia streptococcosis.

Attenuated Streptococcus agalactiae WC1535 ∆Sia perturbs the gut microbiota of Oreochromis niloticus, massively colonizes the intestine, and induces intestinal mucosal immunity after intraperitoneal inoculation

“…FKV was prepared with 0.3% formalin from WC1535. Our previous work showed that LAV ∆Sia, a gene-deleted strain of WC1535 obtained through homologous recombination, confers protection against homologous infection in tilapia (Hao et al, 2022).…”

“…In addition, 100 μL of the mixture was cultured on BHI plates for 48 h to determine if the bacteria were still viable. Similarly, LAV ΔSia (Hao et al, 2022) was prepared by being streaked onto BHI agar, cultured, harvested, and adjusted to the final concentration of 2.0 × 10 9 CFU mL −1 .…”

“…Frontiers in Microbiology 09 frontiersin.org relative abundance of Streptococcus was low in the CTRL21 group (0.13% ± 0.18%), CTRL35 group (0.05% ± 0.07%), FKV21 group (0.02% ± 0.02%), and FKV35 group (1.15% ± 1.01%); rose in the ∆Sia21 group (2.70% ± 1.60%); and dramatically increased in the ∆Sia35H group (70.73% ± 22.09%) and ∆Sia35L group (60.93% ± 33.89%). PCR detection by using the primers neu-dF: CAAAGTTACGCTAGCTATGTGG and neu-dR: AGCATTCAA TAGCAGCACTCC revealed that the GBS with a significantly elevated gut abundance in the ΔSia35H and ΔSia35L groups was predominantly a GBS mutant strain (ΔSia) with the PCR product length of 3,347 bp and not the wild-type strain WC1535 with the PCR product length of 6,226 bp (Hao et al, 2022).…”

“…GBS is a causal agent of tilapia streptococcosis, which has caused serious economic losses (Laith et al, 2017;Zhang et al, 2017;Liu et al, 2019). Studies have shown that the formalin-killed vaccine (FKV) of GBS protected tilapia against GBS infection for up to 180 days (Pasnik et al, 2005), and our previous work demonstrated that in tilapia, a live attenuated vaccine (LAV ∆Sia) conferred protection against homologous GBS infection (Hao et al, 2022). Although considerable research has been conducted on vaccines for tilapia against GBS infection, a systematic comparison of the effects of FKV and LAV on the hindgut mucosal flora and immune response of tilapia has received little attention.…”

Animal social behaviour and gut microbiome

“…GBS is a causal agent of tilapia streptococcosis, which has caused serious economic losses (Laith et al, 2017;Zhang et al, 2017;. Studies have shown that the formalin-killed vaccine (FKV) of GBS protected tilapia against GBS infection for up to 180 days (Pasnik et al, 2005), and our previous work demonstrated that in tilapia, a live attenuated vaccine (LAV ∆Sia) conferred protection against homologous GBS infection (Hao et al, 2022). Although considerable research has been conducted on vaccines for tilapia against GBS infection, a systematic comparison of the effects of FKV and LAV on the hindgut mucosal flora and immune response of tilapia has received little attention.…”