Construction of miniantibodies for the in vivo study of human autoimmune diseases in animal models

Niro, Roberto Di; Ziller, Federica; Florian, Fiorella; Crovella, Sérgio; Stebel, Marco; Bestagno, Marco; Burrone, Óscar R.; Bradbury, Andrew; Secco, Paola; Marzari, Roberto; Sblattero, Daniele

doi:10.1186/1472-6750-7-46

Cited by 40 publications

(29 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The extracellular portion of human ICOS and its mutated form carrying a phenylalanine to serine substitution at position 119 ( F119S ICOS-Fc) were cloned as fusion proteins to the human IgG1 Fc region, generating ICOSFc fusion protein, according to Di Niro et al (15). After transfection, CHO cells stably and highly expressing ICOS-Fc were established.…”

Section: Methodsmentioning

confidence: 99%

B7h Triggering Inhibits Umbilical Vascular Endothelial Cell Adhesiveness to Tumor Cell Lines and Polymorphonuclear Cells

Dianzani¹,

Minelli²,

Mesturini

et al. 2010

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

Vascular endothelial cells (ECs) are key players in leukocyte recruitment into tissues and metastatic dissemination of tumor cells. ECs express B7h, which is the ligand of the ICOS T cell costimulatory molecule. The aim of this work was to assess the effect of B7h triggering by a soluble form of ICOS (ICOS-Fc) on the adhesion of colon carcinoma cell lines to HUVECs. We found that B7h triggering inhibited HUVEC adhesiveness to HT29 and DLD1 cells (by 50 and 35%, respectively) but not to HCT116 cells. The effect was dependent on the ICOS-Fc dose and was detectable as early as 30 min after treatment and was still present after 24 h. It was inhibited by soluble anti-ICOS reagents (mAb and B7h-Fc) and silencing of B7h on HUVECs, and it was not displayed by an F119S mutated form of ICOS-Fc that does not bind B7h. HUVEC treatment with ICOS-Fc did not modulate expression of adhesion molecules and cytokines, but it substantially downmodulated ERK phosphorylation induced by E-selectin triggering or osteopontin, which may influence HUVEC adhesiveness. Moreover, HUVEC treatment with ICOS-Fc also inhibited adhesion of polymorphonuclear cells and several tumor cell lines from different origins. Therefore, the B7h–ICOS interaction may modulate spreading of cancer metastases and recruitment of polymorphonuclear cells in inflammatory sites, which opens a view on the use of ICOS-Fc as an immunomodulatory drug.

show abstract

Section: Methodsmentioning

confidence: 99%

B7h Triggering Inhibits Umbilical Vascular Endothelial Cell Adhesiveness to Tumor Cell Lines and Polymorphonuclear Cells

Dianzani¹,

Minelli²,

Mesturini

et al. 2010

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

show abstract

“…The single-chain fragment variables (scFvs) B2, anti-CD20, and anti-C5 18 (Adienne Pharma and Biotech) were subcloned into the pMB-SV5 19 vector containing the human IgG1 hinge-CH2-CH3 domains to obtain the human scFv-Fc format (MBB2, MBCD20, and MBC5). A CH2-deleted version of the scFv-Fc (DCH2) was generated as previously described 20 using the following primers: Hu_CH3_sense, 59ACGTGCTAGCCACACATGCCCA CCGTGCGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGGCAGC CCCGAGAACCACAGG39;and Hu_CH3_anti, TGCTAAGCTTTTAAG TACTATCCAGGCCCAGCAGTGGGTTTGG.…”

Section: Cloning and Purification Of Recombinant Antibodiesmentioning

confidence: 99%

A non–complement-fixing antibody to β2 glycoprotein I as a novel therapy for antiphospholipid syndrome

Agostinis

Durigutto

Sblattero

et al. 2014

Blood

Self Cite

121

104

View full text Add to dashboard Cite

Key Points• A recombinant antibody recognizing the D1 domain of b2 glycoprotein I induces fetal loss and clot formation in animal models.• The CH2-deleted antibody fails to activate complement and prevents the procoagulant and proabortive effects of patient antibodies.A single-chain fragment variable (scFv) recognizing b2-glycoprotein 1 (b2GPI) from humans and other species was isolated from a human phage display library and engineered to contain an IgG1 hinge-CH2-CH3 domain. The scFv-Fc directed against b2GPI domain I-induced thrombosis and fetal loss, thus mimicking the effect of antibodies from patients with antiphospholipid syndrome (APS). Complement is involved in the biological effect of anti-b2GPI scFv-Fc, as demonstrated by its ability to promote in vitro and in vivo complement deposition and the failure to induce vascular thrombosis in C6-deficient rats and fetal loss in C5-depleted mice. A critical role for complement was also supported by the inability of the CH2-deleted scFv-Fc to cause vessel occlusion and pregnancy failure. This antibody prevented the pathological effects of anti-b2GPI antibodies from APS patients and displaced b2GPI-bound patient antibodies. The CH2-deleted antibody represents an innovative approach potentially useful to treat APS patients refractory to standard therapy. (Blood. 2014;123(22):3478-3487)

show abstract

“…Adding mammalian antibody domains has been used to alter the characteristics of scFvs from various sources [36][37][38]. The present study has shown that the vectors and approaches developed by Greunke et al [24] to create larger bivalent molecules from monovalent chicken antibody fragments can be used for improving avian scFvs which under-perform in certain immunoassay applications.…”

Section: Discussionmentioning

confidence: 93%

Chicken scFvs and bivalent scFv-CH fusions directed against HSP65 of Mycobacterium bovis

et al. 2010

View full text Add to dashboard Cite

a b s t r a c tTwo chicken single-chain variable region antibody fragments (scFvs) that recognised the 65 kDa heatshock protein (HSP65) of Mycobacterium bovis were selected from a large semi-synthetic phage displayed library. Both recognised HSP65 in indirect enzyme-linked immunosorbent assay (ELISA) and immunoblots and retained their activity during storage. Neither, however, could function as the capture reagent in a sandwich ELISA when immobilised on polystyrene. To establish whether they could be engineered for general use in immunotests, the genes coding for these scFvs were subcloned in expression vectors that contained sequences encoding chicken IgY heavy-chain constant region domains. This resulted in larger bivalent constructs which more closely resembled IgY molecules. The engineered fragments were evaluated in ELISAs and gold-conjugated immunochromatographic tests (ICTs). In contrast to their previous behaviour as scFvs, the modified fragments (designated ''gallibodies'') could be used for immunocapture in ELISA and could be readily conjugated to colloidal gold nanoparticles. A sandwich ICT that could detect recombinant HSP65 was also devised. Although converting the recombinant single-chain monomeric antibody fragments to bivalent immunoglobulin-like molecules did not entirely 'standardise' the behaviour of the scFvs, this approach remains potentially useful for developing practical, robust, immunodiagnostic reagents.

show abstract

Construction of miniantibodies for the in vivo study of human autoimmune diseases in animal models

Cited by 40 publications

References 51 publications

B7h Triggering Inhibits Umbilical Vascular Endothelial Cell Adhesiveness to Tumor Cell Lines and Polymorphonuclear Cells

B7h Triggering Inhibits Umbilical Vascular Endothelial Cell Adhesiveness to Tumor Cell Lines and Polymorphonuclear Cells

A non–complement-fixing antibody to β2 glycoprotein I as a novel therapy for antiphospholipid syndrome

Chicken scFvs and bivalent scFv-CH fusions directed against HSP65 of Mycobacterium bovis

Contact Info

Product

Resources

About