Construction of Long-Transcript Enriched cDNA Libraries from Submicrogram Amounts of Total RNAs by a Universal PCR Amplification Method

Abstract

Here we report a novel design of linker primer that allows one to differentially amplify long tracts (average 3.0 kb with size ranges of 1-7 kb) or short DNAs (average 1.5 kb with size ranges of 0.5-3 kb) from a complex mixture. The method allows one to generate cDNA libraries enriched for long transcripts without size selection of insert DNAs. One representative library from newborn kidney includes 70% of clones bearing ATG start codons. A comparable library has been generated from 20 mouse blastocysts, containing only ∼40 ng of total RNA. This universal PCR amplification scheme can provide a route to isolate very large cDNAs, even if they are expressed at very low levels.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers BG060207-BG062928.]A catalog of genes in the form of cDNA clones is the complement to the sequence of genomes, providing not only the confirmation of predicted gene structures, but also the materials for cDNA microarrays and for functional analyses or proteomics (Takahashi and Ko 1994;Lennon et al. 1996;Marra et al. 1999;Strausberg et al. 1999;Tanaka et al. 2000). Because many genes apparently are expressed only at limited times and places during embryogenesis (Ko et al. 2000), a complete cohort requires cDNA libraries from microdissected tissues and small numbers of cells from developing embryos. Because they require large amounts of RNA, conventional cDNA construction methods are precluded for such purposes. The problem is especially acute for full-length cDNA libraries, which require 10-50 µg of polyA+ RNA, equivalent to milligram amounts of total RNA (Maruyama and Sugano 1994;Edery et al. 1995;Carninci et al. 1996Carninci et al. , 1997Carninci et al. , 2000Suzuki et al. 1997Suzuki et al. , 2000.PCR amplification can permit the use of smaller amounts of RNA (Belyavsky et al. 1989), but presents the technical dilemma that it customarily yields a shorter average insert size (e.g., ∼0.5 kb [Peterson et al. 1998] and ∼1.5 kb [Ko et al. 2000]), too short to recover many full-length cDNAs. While working on various linker designs and PCR conditions, we serendipitously found a condition that overcomes size limitations. Here, we report a novel design of linker primer that allows one to differentially amplify long cDNAs or short cDNAs from a complex mixture. RESULTS AND DISCUSSIONTo recover novel genes from mouse embryos, we have been using a PCR-amplification method to construct cDNA libraries. In the original protocol (Takahashi and Ko 1994), doublestranded cDNA mixtures were ligated with a lone linker (LLSal3 [Ko et al. 1990]; Fig. 1A) and amplified by Taq polymerase (Fig. 1B). The resultant cDNA libraries have relatively short inserts (average 0.8 kb, range 0.5-2.5 kb). Subsequent introduction of new enzymes and long PCR methods (Barnes 1994;Cheng et al. 1994) dramatically increased the size of recovered DNA inserts (average 1.5 kb, range 0.5-3.0 kb), and such libraries have been used for a large-scale expressed sequence tag (EST) pr...

Ectopic Pregnancy Rates with Day 3 Versus Day 5 Embryo Transfer: A Retrospective Analysis

“…Sources of tissue materials and RNA extraction methods are available as associated documents in the GenBank DNA sequence records (see also http://lgsun.grc.nia.nih.gov/cDNA/cDNA.html). cDNA libraries were constructed as described elsewhere (Piao et al 2001). More details are available in Protocol S1.…”

“…Twenty-one long-insert-enriched cDNA libraries with insert ranges from 2-8 kb (Piao et al 2001) were generated from preimplantation embryos (unfertilized egg, fertilized egg, two-cell embryo, four-cell embryo, eight-cell embryo, morula, and blastocyst), ES cells (Anisimov et al 2002) and EG cells (Matsui et al 1992), trophoblast stem (TS) cells (Tanaka et al 1998), adult stem cells (e.g., neural stem/progenitor [NS] cells) (Galli et al 2002), mesenchymal stem (MS) cells (Makino et al 1999), osteoblasts (Ochi et al 2003), and hematopoietic stem/progenitor (HS) cells (Ortiz et al 1999), their differentiated cells, and newborn organs (e.g., brain and heart) (see Protocol S1 and Dataset S1 for methods, full list of libraries, and references). In total, 249,200 ESTs (170,059 cDNA clones: 114,437 59 ESTs and 134,763 39 ESTs) were generated and assembled together with public data into a gene index (see Materials and Methods; Protocol S1).…”

Long terminal repeats power evolution of genes and gene expression programs in mammalian oocytes and zygotes

“…7). The gene, first annotated as an anonymous expressed DNA segment D6Ertd527e (Piao et al 2001), formed between glutamine fructose-6-phosphate transaminase 1 (Gfpt1) and anthrax toxin receptor 1 (Antxr1) genes (Supplemental Fig. S6A).…”

Assembly, Verification, and Initial Annotation of the NIA Mouse 7.4K cDNA Clone Set

“…Given that ∼ 12K cDNA clones of NIA mouse 15K are unique, these two sets together represent ∼ 19K unique cDNA clones. NIA mouse 7.4K is composed of both 2652 cDNA clones with an average insert size of ∼ 1.5 kb (Tanaka et al 2000) and 4755 clones enriched for long inserts, with an average insert size ∼ 2.5-3.0 kb (Piao et al 2001). The clone sets are open to the research community without restriction, and are therefore expected to help stimulate the exploration of mammalian embryology, aiding in the construction of DNA microarrays and the biological analysis of clones of interest identified in microarray experiments (see URL A for clone set availability).…”

“…All cDNA clones were constructed with the pSPORT1 vector (Invitrogen) as described previously (Piao et al 2001). Briefly, double-stranded cDNAs were synthesized with an oligo-dT primer (Invitrogen: 5Ј-pGACTAGTTCTAGATCGCGAGCGG CCGCCCTTTTTTTTTTTTTTT-3Ј) from extracted RNA, treated with T4 DNA polymerase, and purified by ethanolprecipitation.…”