Construction of cDNA Libraries from Small Amounts of Total RNA Using the Suppression PCR Effect

Lukyanov, Konstantin A.; Diatchenko, Luda; Chenchik, Alex; Nanisetti, Amulia; Siebert, Paul D.; Usman, Natalia; Matz, Mikhail V.; Lukyanov, Sergey

doi:10.1006/bbrc.1996.5948

Cited by 36 publications

(17 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This method for construction of near-full length and normalized cDNA libraries is based on two advances. The first development is the PCR suppression effect, which makes it possible to construct representative cDNA libraries from small amounts of total RNA (Lukyanov et al 1997;Matz 2002) and to selectively regulate the size of the amplified cDNA fragments (Shagin et al 1999). The second important technical development was the discovery of a novel duplex-specific nuclease from Kamchatka crab that preferentially cleaves perfectly matched duplexes (Shagin et al 2002).…”

Section: Cdna Library Constructionmentioning

confidence: 99%

Decoding the fine-scale structure of a breast cancer genome and transcriptome

Volik¹,

Raphael²,

Huang³

et al. 2006

Genome Res.

View full text Add to dashboard Cite

A comprehensive understanding of cancer is predicated upon knowledge of the structure of malignant genomes underlying its many variant forms and the molecular mechanisms giving rise to them. It is well established that solid tumor genomes accumulate a large number of genome rearrangements during tumorigenesis. End Sequence Profiling (ESP) maps and clones genome breakpoints associated with all types of genome rearrangements elucidating the structural organization of tumor genomes. Here we extend the ESP methodology in several directions using the breast cancer cell line MCF-7. First, targeted ESP is applied to multiple amplified loci, revealing a complex process of rearrangement and coamplification in these regions reminiscent of breakage/fusion/bridge cycles. Second, genome breakpoints identified by ESP are confirmed using a combination of DNA sequencing and PCR. Third, in vitro functional studies assign biological function to a rearranged tumor BAC clone, demonstrating that it encodes antiapoptotic activity. Finally, ESP is extended to the transcriptome identifying four novel fusion transcripts and providing evidence that expression of fusion genes may be common in tumors. These results demonstrate the distinct advantages of ESP including: (1) the ability to detect all types of rearrangements and copy number changes; (2) straightforward integration of ESP data with the annotated genome sequence; (3) immortalization of the genome; (4) ability to generate tumor-specific reagents for in vitro and in vivo functional studies. Given these properties, ESP could play an important role in a tumor genome project.

show abstract

Section: Cdna Library Constructionmentioning

confidence: 99%

Decoding the fine-scale structure of a breast cancer genome and transcriptome

Volik¹,

Raphael²,

Huang³

et al. 2006

Genome Res.

View full text Add to dashboard Cite

show abstract

“…A pseudo-double-stranded adaptor, made of two complementary oligonucleotides (CGACGTGGACTATCCATGAACGCAA-CTCTCCGACCTCTCACCGAGTACG and CGTACTCGGT), was then ligated to the 5Ј end of the double-stranded cDNA. The structure of the adaptors evokes a PCR suppression effect which, through the process of self-annealing, prevents the amplification of molecules that have the adapter ligated to both ends (Lukyanov et al, 1997).…”

Section: Cnidocyte Purificationmentioning

confidence: 99%

Cloning and functional expression of voltage-gated ion channel subunits from cnidocytes of the Portuguese Man O'War Physalia physalis

Bouchard

Price

Moneypenny

et al. 2006

Journal of Experimental Biology

View full text Add to dashboard Cite

SUMMARY Cnidocytes were dissociated from the tentacles of the Portuguese Man O'War Physalia physalis using heat treatment, and purified using density centrifugation. Visual observation confirmed that these cnidocytes contained a nucleus, a cnidocyst and an apical stereocilium, confirming that the cells were intact. A cnidocyte-specific amplified cDNA library was then prepared using RNA isolated from the cnidocytes, and screened for voltage-gated ion channel subunits using conventional molecular cloning techniques. A variety of channel proteins were identified and full-length sequence obtained for two of them, a Ca2+ channel β subunit(PpCaVβ) and a Shaker-like K+channel (PpKV1). The location of the transcripts was confirmed by RT-PCR of total RNA isolated from individually selected and rinsed cnidocytes. The functional properties of these two channel proteins were characterized electrophysiologically using heterologous expression. PpCaVβ modulates currents carried by both cnidarian and mammalian α1 subunits although the specifics of the modulation differ. PpKV1 produces fast transient outward currents that have properties typical of other Shaker channels. The possible role of these channel proteins in the behavior of cnidocytes is discussed.

show abstract

“…This is especially noticeable during the amplification of complex DNA mixtures containing more than one fragment. Such a situation arises during the preparation of amplified cDNA samples (2), during the amplification of cDNA ends (3)(4)(5) and during PCR-based genome walking (6). In all of these cases the bias towards shorter DNA fragments may pose significant problems during subsequent cloning and analysis of the PCR product.…”

Section: Introductionmentioning

confidence: 99%

Regulation of average length of complex PCR product

Shagin

Lukyanov

Vagner

et al. 1999

Nucleic Acids Research

View full text Add to dashboard Cite

A method to achieve the preference towards longer products during PCR is described. The extent of this preference can be adjusted by slight variation of the PCR conditions. Being combined with the natural tendency of PCR to amplify shorter fragments more efficiently than longer ones, it allows one to regulate the average length of the complex PCR product over a very wide range to make it most suitable for further manipulations. The technique can be used for amplifying any complex DNA sample.

show abstract

Construction of cDNA Libraries from Small Amounts of Total RNA Using the Suppression PCR Effect

Cited by 36 publications

References 17 publications

Decoding the fine-scale structure of a breast cancer genome and transcriptome

Decoding the fine-scale structure of a breast cancer genome and transcriptome

Cloning and functional expression of voltage-gated ion channel subunits from cnidocytes of the Portuguese Man O'War Physalia physalis

Regulation of average length of complex PCR product

Contact Info

Product

Resources

About