Constitutively active NDR1-PIF kinase functions independent of MST1 and hMOB1 signalling

Abstract

The human MST1/hMOB1/NDR1 tumour suppressor cascade regulates important cellular processes, such as centrosome duplication. hMOB1/NDR1 complex formation appears to be essential for NDR1 activation by autophosphorylation on Ser281 and hydrophobic motif (HM) phosphorylation at Thr444 by MST1. To dissect these mechanistic relationships in MST1/hMOB1/NDR signalling, we designed NDR1 variants carrying modifications that mimic HM phosphorylation and/or abolish hMOB1/NDR1 interactions. Significantly, the analyses of these variants revealed that NDR1-PIF, an NDR1 variant containing the PRK2 hydrophobic motif, remains hyperactive independent of hMOB1/NDR1-PIF complex formation. In contrast, as reported for the T444A phospho-acceptor mutant, NDR1 versions carrying single phospho-mimicking mutations at the HM phosphorylation site, namely T444D or T444E, do not display increased kinase activities. Collectively, these observations suggest that in cells Thr444 phosphorylation by MST1 depends on the hMOB1/NDR1 association, while Ser281 autophosphorylation of NDR1 can occur independently. By testing centrosome-targeted NDR1 variants in NDR1- or MST1-depleted cells, we further observed that centrosome-enriched NDR1-PIF requires neither hMOB1 binding nor MST1 signalling to function in centrosome overduplication. Taken together, our biochemical and cell biological characterisation of NDR1 versions provides novel unexpected insights into the regulatory mechanisms of NDR1 and NDR1's role in centrosome duplication.

Mitochondrial clearance by the STK38 kinase supports oncogenic Ras-induced cell transformation

“…To test whether STK38 signalling plays a role in this setting, we assessed the consequences of STK38 depletion using three different siRNAs (Figure 1) and overexpression of hyperactive STK38-PIF (Supplementary Figure S1). This revealed that HK-HT cells expressing oncogenic HRasG12V (henceforth called HK-HRasG12V) with transient STK38 depletion displayed significantly decreased soft agar colony formation (Figure 1A, 1B, 1C), while expression of hyperactive STK38-PIF [38] was not sufficient to transform HK-HT cells (Supplementary Figure S1). Although human STK38L (aka NDR2) is similar to human STK38 [26, 27], efficient STK38L depletion in HK-HRasG12V had no effect on anchorage-independent growth (Figure 1D, 1E, 1F).…”

“…Retroviral plasmids encodingHRasG12V, HRasG12V/E37G, HA-STK38 PIF, HA-STK38 PIF/kd, and shLUC have been reported [34, 38, 62]. To generate the pSuper.retro.puro_shSTK38-2 vector expressing shRNAs against human STK38, the following oligonucleotide pairs were inserted into pSuper.retro.puro (Oligoengine) using BglII and HindIII : 5′-GATCCCCGTCGGCCATAAACAGCTATTCAAGAGATAGCTGTTTATGGCCGACGTTTTTGGAAA-3′ and 5′- AGCTTTTCCAAAAACGTCGGCCATAAACAGCTATCTCTTGAATAGCTGTTTATGGCCGACGGG-3′ targeting the 3′UTR of STK38.…”

A Hippo-like Signaling Pathway Controls Tracheal Morphogenesis in Drosophila melanogaster

“…The characterization of Tao-1 and TAO1 binding to GCKIII kinases was carried out in low-stringency buffer as defined previously (Cook et al, 2014). Anti-HA antibodies were from Cell Signaling (C29F4) and Roche (3F10).…”

STK 38 kinase acts as XPO 1 gatekeeper regulating the nuclear export of autophagy proteins and other cargoes

“…To investigate whether STK38's kinase activity is required for its nuclear/cytoplasmic shuttling, HeLa cells were silenced for endogenous STK38 followed by transient expression of wild-type STK38 (wt), kinase-dead (K118R) [3], or constitutively active (PIF) STK38 [28]. Transfected cells were subsequently submitted to nutrient starvation and stained for STK38 subcellular localization ( Fig 3A and B).…”