Constitutive Activation of the PrfA Regulon Enhances the Potency of Vaccines Based on Live-Attenuated and Killed but Metabolically Active Listeria monocytogenes Strains

Abstract

Recognition of the advantages of recombinant Listeria monocytogenes-based vaccines compared to those of other recombinant-vaccine platforms has facilitated the ongoing development and current evaluation of the former in early-phase clinical trials. These advantages include practical considerations, such as straightforward fermentation methods for manufacturing, and other desirable features, such as the ability to repeat administer even in the presence of protective L. monocytogenes-specific immunity (6,40,41). One compelling rationale for this vaccine platform is based on the well-known correlates of protection in the mouse listeriosis model: longlived functional CD4 ϩ and CD8 ϩ memory T cells induced in response to a single immunization with L. monocytogenes (19,28). There are now numerous publications that demonstrate the striking efficacy of recombinant L. monocytogenes vaccines in several animal models due to robust innate and adaptive cellular immunity (9,10,29). Recombinant L. monocytogenesbased vaccines represent an emerging approach to addressing an acute global need for effective vaccines that elicit functional cellular immunity to prevent or treat infections such as human immunodeficiency virus infection, hepatitis C virus infection, tuberculosis, and malaria as well as cancer.As L. monocytogenes is a food-borne pathogen having increased virulence among immunocompromised individuals, attenuated vaccine platforms are a prerequisite for advancement to evaluation with humans (23). We have previously described both live-attenuated and photochemically inactivated vaccine platforms derived from the wild-type (WT) strain 10403S (8, 9). The live-attenuated vaccine strain is deleted of both the actA and the inlB virulence genes (L. monocytogenes ⌬actA ⌬inlB vaccine strain), which in combination limit growth in the liver, a principal target organ of infection by the WT organism. Liver toxicity in mice, as measured by serum liver function tests for alanine transaminase and aspartate transaminase, is dramatically lower in mice injected intravenously (i.v.) with the L. monocytogenes ⌬actA ⌬inlB strain than in those injected i.v. with WT L. monocytogenes. Furthermore, liver toxicity was minimal and not dose limiting in two toxicology studies performed under good laboratory practice guidelines with cynomolgus monkeys given escalating doses of L. monocytogenes ⌬actA ⌬inlB-based strains (unpublished data). The L. monocytogenes ⌬actA ⌬inlB vaccine strain forms the basis for two ongoing FDA-approved phase 1 clinical trials being conducted with adult subjects with advanced cancers. The second vaccine platform, termed "killed but metabolically active" (KBMA), is derived from the L. monocytogenes ⌬actA ⌬inlB vaccine strain and is deleted of both uvrA and uvrB, genes encoding the DNA

Listeria-Vectored Vaccine Expressing the Mycobacterium tuberculosis 30-Kilodalton Major Secretory Protein via the Constitutively Active prfA * Regulon Boosts Mycobacterium bovis BCG Efficacy against Tuberculosis

“…As shown in Fig. 1c, the density of the 31-kDa protein band from LmIII/h30 (with the PrfA* mutation) (lane 5) was 13-and 11-fold higher than those of the bands from LmI/h30 (lane 3) and LmII/h30 (lane 4) (without the PrfA* mutation), respectively; similarly, the density of the 39-kDa protein band from LmIII/a30 (lane 8) was 28-fold higher than that of the band from LmII/a30 (lane 7), indicating that the mutation in the prfA* regulon enhanced the expression of the PrfA-dependent genes, consistent with results reported previously by Yan et al and Lauer et al (13,14). Moreover, the density of the 31-kDa protein band expressed by rLmIII/h30 (r30 driven by the hly promoter) (Fig.…”

“…Of note, in J774 cells, the different L. monocytogenes vectors expressed equivalent amounts of h30 or a30. This contrasts with the differing levels of expression of these proteins by the same vectors in broth culture; with respect to the LmIII vector, this finding is consistent with those reported by Lauer et al (14). The growth kinetics of the selected rLm30 vaccines in J774 cells were similar to those of the parental LmI and LmIII vectors (Fig.…”

“…All animals were maintained in a specific-pathogen-free animal facility and used according to protocols approved by the UCLA Institutional Animal Care and Use committee. (12,14), we constructed five rLm30 vaccine candidates expressing h30 or a30 as described previously by us and by others (17,39,40). Briefly, to construct rLm30 vaccine candidates expressing h30 or a30, we optimized the coding sequence for r30 for expression in L. monocytogenes; synthesized (DNA2.0, Newark, CA) and cloned it into a phage-based Listeria sitespecific integration vector derived from pPL1 (pDP4189; kindly provided by J. F. Miller) or pPL2e (kindly provided by J. Skoble) (40), respectively; and subsequently integrated it at the 3= end of tRNA Arg on the bacterial chromosome of the recipient LmI, LmII, or LmIII as described previously by us (39) and by others (40).…”

“…Recent studies have shown that vaccines engineered based on the L. monocytogenes ΔactA strain or the killed but metabolically active L. monocytogenes ΔactA ΔinlB prfA* strain, while remaining attenuated, significantly enhance vaccine-elicited T-cell-mediated and humoral immune responses (13)(14)(15). The PrfA*(G155S) mutation results in the constitutive overexpression of PrfA and PrfA-dependent genes in broth culture but equivalent expression in macrophage and dendritic cell lines (13,14). The L. monocytogenes hly and actA promoters are regulated differently in broth and in macrophages (16).…”

The Listeria monocytogenes Hibernation-Promoting Factor Is Required for the Formation of 100S Ribosomes, Optimal Fitness, and Pathogenesis

“…Briefly, ϳ900-bp fragments upstream and downstream of the hpf open reading frame (ORF), including the first seven and the last four codons of the gene, were amplified with the primer pairs AAGCTATCTCTCACATTCAAAAAATGAATCAA/taaattat tattttaaattagtttgtttcACGAATGTTGTACTTAAGCATAGCAATT and AA TTGCTATGCTTAAGTACAACATTCGTgaaacaaactaatttaaaataataattta/t ggagaagcggaaaaatcgactattctatat. Upstream and downstream fragments were joined by splicing by overhang extension PCR (SOE PCR) (24), cloned into the oriT-containing suicide vector pBHE261 (25), and transferred into L. monocytogenes by conjugation. Integration and excision of the plasmid to generate an in-frame deletion were performed as previously described.…”