Connective tissue growth factor autocriny in human hepatocellular carcinoma: Oncogenic role and regulation by epidermal growth factor receptor/yes-associated protein-mediated activation

Abstract

The identification of molecular mechanisms involved in the maintenance of the transformed phenotype of hepatocellular carcinoma (HCC) cells is essential for the elucidation of therapeutic strategies. Here, we show that human HCC cells display an autocrine loop mediated by connective tissue growth factor (CTGF) that promotes DNA synthesis and cell survival. Expression of CTGF was stimulated by epidermal growth factor receptor (EGFR) ligands and was dependent on the expression of the transcriptional coactivator, Yes-associated protein (YAP). We identified elements in the CTGF gene proximal promoter that bound YAP-enclosing complexes and were responsible for basal and EGFR-stimulated CTGF expression. We also demonstrate that YAP expression can be up-regulated through EGFR activation not only in HCC cells, but also in primary human hepatocytes. CTGF contributed to HCC cell dedifferentiation, expression of inflammation-related genes involved in carcinogenesis, resistance toward doxorubicin, and in vivo HCC cell growth. Importantly, CTGF down-regulated tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) receptor 2 expression and was involved in the reduced sensitivity of these cells toward TRAIL-mediated apoptosis. Conclusion: We have identified autocrine CTGF as a novel determinant of HCC cells' neoplastic behavior. Expression of CTGF can be stimulated through the EGFR-signaling system in HCC cells in a novel cross-talk with the oncoprotein YAP. Moreover, to our knowledge, this is the first study that identifies a signaling mechanism triggering YAP gene expression in healthy and transformed liver parenchymal cells.

MiR-506 suppresses proliferation of hepatoma cells through targeting YAP mRNA 3′UTR

“…YAP, an essential downstream effector of the Hippo pathway, is frequently highly expressed in a wide spectrum of human solid tumors [26,27] . It has been reported that YAP promotes proliferation in liver by regulating the transcription of certain target genes, including Ki-67, CTGF, c-Myc, sex-determining region Y-related high-mobility group box 4 (SOX4), H19, and alpha-fetoprotein (AFP) [19,20,28] . In clinical studies, YAP is an independent predictor of poor disease free survival (DFS) and overall survival (OS) in HCC [29] .…”

YAP oncogene overexpression supercharges colon cancer proliferation

“…Nevertheless, because YAP transcriptional regulation requires its TEAD association and/ or the WW domains, the latter interacting with PPXY-bearing targets, it may be feasible to identify small-molecule inhibitors of those interactions with sufficient specificity. Regarding transcriptional targets critical for oncogenic activity downstream of YAP, BIRC5/Survivin and the extracellular ligands connective tissue growth factor (CTGF) 76,77 and Amphiregulin, 78 appear relevant in certain contexts; however, the full spectrum of YAP targets and their contributions to tumorigenesis in vivo remain to be defined.…”

MEK1 promotes YAP and their interaction is critical for tumorigenesis in liver cancer

“…Cells were treated by PD98059 (15-50 lM, Cell Signaling Technology (CST), Boston, MA, USA) or U0126 (1)(2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20) lM, CST) 24 h before harvest. ShRNAs were cloned into pLKO.1 lentiviral vectors using primers as follows: MEK1-sh#1-Forward: CCGGAACTCTGGATCAAGTCCTGAACTCGAGTTCAGGACTTGATCCA-GAGTTTTTTTG and Reward: AATTCAAAAAAACTCTGGATCAAGTC C TGAACTCGAGTTCAGGACTTGATCCAGAGTT; MEK1-sh#2-Forward: CCGGAAGGACTCATTACTCTGTGCACTCGAGTGCACAGAGTAATGAGT CCTTTTTTTG and Reward: AATTCAAAAAAAGGACTCATTACTCTG TGCACTCGAGTGCACAGAGTAATGAGTCCTT.…”

“…Ectopic increased expression of YAP in the immortalized non-tumorigenic hepatocyte cell line confers tumorigenic and metastatic potentials [4]. YAP contributes to human hepatocellular carcinoma (HCC) cell dedifferentiation, expression of inflammation-related genes involved in carcinogenesis, resistance toward doxorubicin, and in vivo HCC cell growth through induction of connective tissue growth factor (CTGF) [5]. By using cross-species analysis of expression data, the Notch ligand Jagged-1 (Jag-1) was identified as a downstream target of YAP in HCC cells.…”