Conditional Deletion of the Relaxin Receptor Gene in Cells of Smooth Muscle Lineage Affects Lower Reproductive Tract in Pregnant Mice1

Abstract

Relaxin hormone secreted into the circulation during pregnancy was discovered through its effects on pubic symphysis relaxation and parturition. Genetic inactivation of the relaxin gene or its cognate relaxin family peptide receptor 1 (RXFP1) in mice caused failure of parturition and mammary nipple enlargement, as well as increased collagen fiber density in the cervix and vagina. However, the relaxin effect on discrete cells and tissues has yet to be determined. Using transgenic mice with a knockin LacZ reporter in the Rxfp1 allele, we showed strong expression of this gene in vaginal and cervical stromal cells, as well as pubic ligament cells. We produced a floxed Rxfp1 allele that was used in combination with the Tagln-cre transgene to generate mice with a smooth muscle-specific gene knockout. In pregnant females, the ROSA26 reporter activated by Tagln-cre was detected in smooth muscle cells of the cervix, vagina, uterine artery, and in cells of the pubic symphysis. In late pregnant females with conditional gene ablation, the length of pubic symphysis was significantly reduced compared with wild-type or heterozygous Rxfp1(+/-) females. Denser collagen content was revealed by Masson trichrome staining in reproductive tract organs, uterine artery, and pubic symphysis. The cervical and vaginal epithelium was less developed than in heterozygous or wild-type females, although nipple size was normal and the dams were able to nurse their pups. In summary, our data indicate that relaxin/RXFP1 signaling in smooth muscle cells is important for normal collagen turnover and relaxation of the pubic symphysis during pregnancy.

The actions of relaxin on the human cardiovascular system

“…In RXFP1 receptor KO mice, relaxin‐induced increases in NO production by endothelial cells were abolished (Segal et al , ). No reduction in tissue collagen content and remodelling of the reproductive tract was seen in conditional RXFP1 receptor KO mice, a phenotype similar to that of relaxin KO mice (Krajnc‐Franken et al , ; Kaftanovskaya et al , ).…”

Human Relaxin Receptor Is Fully Functional in Humanized Mice and Is Activated by Small Molecule Agonist ML290

“…Presence of the humanized allele was detected by PCR of ear DNA with human-specific primers hLGR7ex1/2bpF, TGACATCTGGTTCTGTCTTCTTCT, and hLGR7ex2/158bpR, CAGTCGTCCACACCGTTACA. Mice with the knockout allele of Rxfp1 , Rxfp1-LacZ , were also used in this study, and the presence of this allele was detected with LacZ-specific primers as described in the original publication [ 8 ]. All mice used in this study were on the C57BL/6 background.…”

“…The effects of human RXFP1 knock-in were studied in late pregnant females at day 18.5 after vaginal plug detection as described previously [ 8 ]. Females were euthanized by CO 2 overexposure and their reproductive organs measured, collected, and fixed in 4% paraformaldehyde.…”

“…Analysis of the phenotype of Rln1 - or Rxfp1 -deficient mice revealed several abnormal features [ 5 – 8 ]. Some mutant females were unable to deliver pups because of failure of the pubic symphysis to dilate.…”

Across‐breed validation study confirms and identifies new loci associated with sexual precocity in Brahman and Nellore cattle

“…On BTA15, TAGLN was associated with endometriosis (dos Santos Hidalgo, Meola, Silva, Paz, & Ferriani, 2011). This gene was also detected in reproductive tract of pregnant mice and hens (Kaftanovskaya, Huang, Lopez, Conrad, & Agoulnik, 2015;Riou, Saint-Dizier, & Gérard, 2015). On BTA16, the gene LMOD1 was regulated by androgen and progesterone receptors in the human endometrium affecting the decidualizing process (Cloke et al, 2008).…”