Comprehensive characterization of secreted aspartic proteases encoded by a virulence gene family in Candida albicans

Abstract

Candida albicans is a commensal organism, but causes life-threatening infections in immunocompromised patients. Certain factors such as yeast-hyphae transition and hydrolytic enzymes are suggested as virulence attributes of C. albicans. Among them, 10 types of secreted aspartic protease (SAP) genes have received particular attention as a major virulence gene family. However, their full functional repertoire, including its biochemical properties, remains to be elucidated. Hence, we purified all Sap isozymes using Pichia pastoris and comprehensively determined and compared their biochemical properties. While optimum pH of Sap7 was 6.5 and that of Sap8 was 2.5, presence of other Sap isozymes functioning within a broad range of optimum pH could allow C. albicans to survive and cause infections in various tissues. The substrate specificities of Sap isozymes were analysed by using FRETS-25Xaa libraries. Sap7 and Sap10 showed high substrate specificity, while other Sap isozymes had broad substrate specificities. Principal component analysis revealed that the 10 Sap isozymes were clustered into 3 distinct groups in terms of their substrate specificities. Interestingly, Sap4-6, which are coproduced in the hyphal form, were clustered as the same group, indicating that they may target similar host proteins. These results will lead to further understanding of C. albicans pathogenicity.

Design of a Novel Antimicrobial Peptide Activated by Virulent Proteases

“…The average degradation rates of each sublibrary were calculated, and we found that Saps1-3 preferred the FRETS-25K and FRETS-25R sublibraries ( Figure 2B). In addition, LC ⁄ MS analysis showed that almost all peptides were cleaved between Xaa and Ala as described in a previous study (15). These results indicated that Saps1-3 preferred basic amino acids at the P 1 (Xaa) position.…”

“…The C. albicans strain SC5314 (American Type Culture Collection) and Saccharomyces cerevisiae strain BY4741 [MATa, his3, leu2, met15, ura3] (Euroscarf) were used to measure the fungicidal activity of the AMPs. For protein production, P. pastoris transformants were precultivated in buffered glycerol-complex (BMGY) medium [1% (w ⁄ v) yeast extract, 2% (w ⁄ v) peptone, 1.34% (w ⁄ v) yeast nitrogen base (YNB) without amino acids, 4 · 10 Production and purification of Sap isozymes Secreted aspartic proteases isozymes were produced by P. pastoris according to the previously described method (15). In brief, the P. pastoris transformants were grown in BMGY media for 48 h at 30°C.…”

“…Determination of substrate specificity of Sap isozymes The substrate specificities of the Sap isozymes were determined using the FRETS-25Xaa library (Figure 2A; Peptide Institute, Osaka, Japan) as described in previous studies (15,16). In brief, the library contains 475 peptides, separated into 19 sublibraries.…”

The expression of the Candida albicans gene SAP4 during hyphal formation in human serum and in adhesion to monolayer cell culture of colorectal carcinoma Caco-2 (ATCC)

“…We chose to analyze the expression of SAP4 as one of three genes clustered into one group in terms of their sequence homology as well as their substrate specificity [23,24]. Moreover, of the three genes examined, SAP4 expression had minimal study in C. albicans during epithelial cells colonisation and infection [36].…”

Evaluation of Mdh1 Protein as an Antigenic Candidate for a Vaccine against Candidiasis

“…The plasmid pQE-mdh1, which was used to produce Mdh1p in E. coli, was constructed by first using PCR to amplify the Mdh1p coding sequence using the primers 5 -CATCACCATCACGGATCCTTTTCAAAAGTTGCT ACTAGATCATTTTCCTCTTC-3 and 5 -CTCAGCTAAT TAAGCTT0TTATGGGTTTTGAGCAACAAAGTCAA CACC -3 and genomic DNA of C. albicans strain SC5314 American Type Culture Collection , which was purified as described previously Aoki et al, 2011 . The amplified fragment of the Mdh1p coding sequence was inserted into the pQE30 plasmid QIAGEN, Hilden, Germany that had been digested with BamHI and HindIII, and the resultant plasmid was named pQE-mdh1.…”