Comprehensive Analysis of Rhesus Lymphocryptovirus MicroRNA Expression

Abstract

Rhesus lymphocryptovirus (rLCV) and Epstein-Barr virus (EBV) are closely related gammaherpesviruses that infect and cause disease in rhesus monkeys and humans, respectively. Thus, rLCV is an important model system for EBV pathogenesis. Both rLCV and EBV express microRNAs (miRNAs), several conserved in sequence and genomic location. We have applied deep sequencing technology to obtain an inventory of rLCV miRNA expression in latently rLCV-infected monkey B cells. Our data confirm the presence of all previously identified mature rLCV miRNAs and have resulted in the discovery of 21 new mature miRNAs arising from previously identified precursor miRNAs (pre-miRNAs), as well as two novel pre-miRNAs (rL1-34 and rL1-35) that together generate four new mature miRNAs. Thus, the total number of rLCV-encoded pre-miRNAs is 35 and the total number of rLCV mature miRNAs is 68, the most of any virus examined. The exact 5 and 3 ends of all mature rLCV miRNAs were pinpointed, many showing marked sequence and length heterogeneity that could modulate function. We further demonstrate that rLCV mature miRNAs associate with Argonaute proteins in rLCV-infected B cells. Epstein-Barr virus (EBV) is a gammaherpesvirus that produces self-limiting disease or asymptomatic infection in Ͼ90%of the human population and can trigger specific malignancies including Burkitt's and other lymphomas, nasopharyngeal and gastric carcinomas, and a variety of tumors in immunocompromised patients (55). The full extent of EBV's contribution to cancer is unknown, despite known viral interference with cell cycle regulation and apoptosis (29). EBV establishes life-long infection as a double-stranded DNA episome, persisting latently in a human B-cell subpopulation from which the virus periodically reactivates (55). Therefore, the interplay between EBV and the host immune system is key to EBV pathogenesis and associated malignancies.Animal models play a crucial role in the study of host-virus interactions. Tissue culture models of EBV have been important for the study of many aspects of the virus, but such experiments cannot be used to explore why only certain infected individuals develop malignancies and how the host immune system factors into the viral life cycle. EBV belongs to the lymphocryptovirus subgroup, which includes rhesus lymphocryptovirus (rLCV), a remarkably conserved virus that is evolutionarily separated from EBV by Ͼ13 million years (12, 49). rLCV infects Old World nonhuman primates, its natural host being the rhesus monkey (Macaca mulatta) (46). In addition to extensive genomic sequence conservation, homologous genes are expressed by rLCV and EBV during both latent and lytic infections (49; reviewed in reference 61). Additionally, major characteristics of EBV biology are shared by rLCV, including the high rate of adult infection, persistent latent infection in the peripheral blood and oropharynx, and most importantly, the potential for rLCV-induced malignancies in hosts (36,46,48). Infection of rhesus monkeys by rLCV has therefore become a key a...

Identification and Expression Analysis of Herpes B Virus-Encoded Small RNAs

“…Therefore, even differences of 1 nt at the 5Ј end potentially alter the target mRNAs. miRNA sequence heterogeneity has been observed in humans (45), Drosophila melanogaster (31), Caenorhabditis elegans (27), and herpesviruses, including KSHV (37), HSV (39), and rLCV (27). In all three of these herpesviruses, it was reported that 3Ј-end variation occurred more frequently than 5Ј-end variation (27,37,39).…”

High-Resolution Profiling and Analysis of Viral and Host Small RNAs during Human Cytomegalovirus Infection

“…Recent reports have identified that miRNAs encoded by other herpesviruses associate with host silencing complexes (8,27). To confirm whether HCMV miRNAs are indeed incorporated into these complexes, we performed CLIP-seq (cross-linking and immunoprecipitation followed with high-throughput sequencing) experiments against Ago proteins for mock-infected and infected HFFs at 24 and 72 hpi (Fig.…”

“…These small RNAs (smRNAs) are highly attractive from a viral standpoint in that they require minimal space within the genome and potentially offer a robust mechanism for specific targeting of host defense genes. HCMV is known to encode at least 11 miRNA precursors that are expressed and processed into mature miRNAs during infection (12).High-throughput sequencing approaches have been instrumental in recent viral miRNA studies, acquiring a level of resolution that was previously unachievable through cloning efforts (17,27,36). Deep-sequencing approaches have not been extended to smRNA analysis of HCMV-infected cells, and previous microarray-based studies were limited in assessing only host miRNA levels (30,37).…”

“…High-throughput sequencing approaches have been instrumental in recent viral miRNA studies, acquiring a level of resolution that was previously unachievable through cloning efforts (17,27,36). Deep-sequencing approaches have not been extended to smRNA analysis of HCMV-infected cells, and previous microarray-based studies were limited in assessing only host miRNA levels (30,37).…”

Association of Argonaute proteins and microRNAs can occur after cell lysis

“…Northern blots were carried out as previously published (Riley et al 2010). The ebv-miR-BHRF1-2 and hsa-miR-16 miRNAs were probed with 59 phosphate radiolabeled TCAATTTCTGCCG CAAAAGATA and CGCCAATATTTACGTGCTGCTA, respectively.…”