Complete, Programmable Decoding of Oxidized 5-Methylcytosine Nucleobases in DNA by Chemoselective Blockage of Universal Transcription-Activator-Like Effector Repeats

Abstract

5-Methylcytosine (5mC) and its oxidized derivatives are regulatory elements of mammalian genomes involved in development and disease. These nucleobases do not selectively modulate Watson-Crick pairing, preventing their programmable targeting and analysis by traditional hybridization probes. Transcription-activator-like effectors (TALEs) can be engineered for use as programmable probes with epigenetic nucleobase selectivity. However, only partial selectivities for oxidized 5mC have been achieved so far, preventing unambiguous target binding. We overcome this limitation by destroying and re-inducing nucleobase selectivity in TALEs via protein engineering and chemoselective nucleobase blocking. We engineer cavities in TALE repeats and identify a cavity that accommodates all eight human DNA nucleobases. We then introduce substituents with varying size, flexibility, and branching degree at each oxidized 5mC. Depending on the nucleobase, substituents with distinct properties effectively block TALE-binding and induce full nucleobase selectivity in the universal repeat. Successful transfer to affinity enrichment in a human genome background indicates that this approach enables the fully selective detection of each oxidized 5mC in complex DNA by programmable probes.

Experience with German Research Consortia in the Field of Chemical Biology of Native Nucleic Acid Modifications

“…47−51 Insights from molecular recognition have also been used for targeted manipulation of DNA, again specifically related to the above-mentioned cytidine derivatives. 57,58 In the chemical biology of cofactors, one focus was on SAM analogs, 14,28,59 another was on canonical and noncanonical cap structures and the structural elucidation of related enzymes. 60−62 Structural elucidation by synthesis of complicated hypermodifications from tRNAs 63,64 was in the spirit of a general revival of the functional analysis of such modifications.…”

Imaging-Based In Situ Analysis of 5-Methylcytosine at Low Repetitive Single Gene Loci with Transcription-Activator-Like Effector Probes

“…TALEs bind one strand of double stranded DNA via a programmable domain of concatenated repeats, each recognizing one nucleobase via a so-called repeat variable diresidue (RVD, Figure b), thus offering DNA sequence recognition with nucleotide resolution. , A number of repeats have been engineered to exhibit selectivity for epigenetically modified cytosines, or to show universal binding of nucleobases. − Our imaging approach relied on costains of fixed mammalian cells with two different TALEs being fused to two different fluorescent proteins. One TALE thereby binds a target CpG cytosine with an HD RVD that is blocked by 5mC (Figure c), the other TALE binds the same cytosine in the target with the RVD G* that universally binds to any nucleobase with similar affinities (including C and 5mC; Figure d) …”

“…One TALE thereby binds a target CpG cytosine with an HD RVD that is blocked by 5mC ( Figure 1 c), the other TALE binds the same cytosine in the target with the RVD G* that universally binds to any nucleobase with similar affinities (including C and 5mC; Figure 1 d). 18 …”

Designer Receptors for Nucleotide‐Resolution Analysis of Genomic 5‐Methylcytosine by Cellular Imaging

“…We evaluated TALEs of varying length targeting the SATIII consensus sequence "TGGAACGGAACGGAATGGAAT GGAATGGAA" by microscopy of stained HeLa cells and electromobility-shift assays (Figure 2 a,b and Supporting Information S1-2), and proceeded with a 17 repeat TALE, termed TALE_2 (for two CpGs in the target, Figure 1 b). We initially expressed two TALE_2 versions, bearing at CpG repeat positions 5 and 10 either an HD RVD selectively binding C (and being blocked by 5mC), or the RVD G* binding any nucleobase (including 5mC, [20] Figure 1 b). In vitro footprinting assays confirmed 5mC sensitivity of the HD TALE with nucleotide/strand resolution, and universal binding of the G* TALE (Figure 2 c and the Supporting Information).…”