Complete genome anatomy of the emerging potato pathogen Dickeya solani type strain IPO 2222T

Abstract

Several species of the genus Dickeya provoke soft rot and blackleg diseases on a wide range of plants and crops. Dickeya solani has been identified as the causative agent of diseases outbreaks on potato culture in Europe for the last decade. Here, we report the complete genome of the D. solani IPO 2222T. Using PacBio and Illumina technologies, a unique circular chromosome of 4,919,833 bp was assembled. The G + C content reaches 56% and the genomic sequence contains 4,059 predicted proteins. The ANI values calculated for D. solani IPO 2222T vs. other available D. solani genomes was over 99.9% indicating a high genetic homogeneity within D. solani species.Electronic supplementary materialThe online version of this article (doi:10.1186/s40793-016-0208-0) contains supplementary material, which is available to authorized users.

The phytopathogenic nature of Dickeya aquatica 174/2 and the dynamic early evolution of Dickeya pathogenicity

“…These features are typical of Dickeya species (Supporting Information Table S2). The origin of chromosome replication ( oriC position 1–8 bp) was predicted between mnmG/gidA and mioC as observed in Escherichia coli (Wolanski et al ., ) and other enterobacterales, including Dickeya (Glasner et al ., ; Zhou et al ., ; Khayi et al ., ). The terminus of replication is predicted between positions 2 220 802 and 2 220 829 bp with the D. aquatica 174/2 T Dif site (GGT T CGCATAATGTATATTATGTTAAAT) differing from the E. coli K‐12 Dif site by only one nucleotide substitution (GGT G CGCATAATGTATATTATGTTAAAT).…”

“…The protein coding density is 85% of the genome with a slight preference for the leading strand utilization (57%). This density of predicted ORFs (slightly less than one per kilobase) is typical for Enterobacterales , including Dickeya species (Supporting Information Table S2; Glasner et al ., ; Zhou et al ., ; Khayi et al ., ). Thus, despite its different ecological niche, D. aquatica shows genomic organization very similar to other species of the Dickeya genus.…”

“…This figure was drawn using Gview https://server.gview.ca/. Information Table S2; Glasner et al, 2011;Zhou et al, 2015;Khayi et al, 2016). Thus, despite its different ecological niche, D. aquatica shows genomic organization very similar to other species of the Dickeya genus.…”

Isolation and characterization of pectolytic bacterial pathogens infecting potatoes in Nakuru County, Kenya

“…; Khayi et al . ). Other species of Pectobacterium include the recently isolated Pectobacterium parmentieri (Suárez et al .…”

“…Species belonging to Pectobacterium and Dickeya are the most common of the soft rot Enterobacteriaceae and affect a wide range of plant species both in the tropical and temperate regions (P erombelon 1992;Ma et al 2007;Toth et al 2011). The most important species in the genus Pectobacterium include Pectobacterium carotovorum and Pectobacterium atrosepticum while in the genus Dickeya the most important species include Dickeya solani and Dickeya dadantii (Charkowski 2006;Toth et al 2011;Degefu et al 2013;Khayi et al 2016). Other species of Pectobacterium include the recently isolated Pectobacterium parmentieri (Su arez et al 2017) and Pectobacterium polaris (Dees et al 2017).…”