Comparison of Two Commercial Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Modified Live Vaccines against Heterologous Type 1 and Type 2 PRRSV Challenge in Growing Pigs

Abstract

The objective of the present study was to compare the efficacy of two commercial type 1 porcine reproductive and respiratory syndrome virus (PRRSV) modified live vaccines against heterologous type 1 and type 2 PRRSV challenge in growing pigs. Vaccination with a type 1 PRRSV vaccine reduced the level of viremia after type 1 PRRSV challenge but did not reduce the level of viremia after the type 2 PRRSV challenge in pigs. Increased levels of interleukin-10 (IL-10) stimulated by type 2 PRRSV coincided with the low numbers of type 2 PRRSV-specific interferon gamma-secreting cells (IFN-␥-SC) in vaccinated pigs after type 2 PRRSV challenge, whereas low levels of IL-10 stimulated by type 1 PRRSV coincided with high numbers of type 1 PRRSV-specific IFN-␥-SC in vaccinated pigs after type 1 PRRSV challenge. Additionally, vaccination with the type 1 PRRSV vaccine effectively reduced the lung lesions and type 1 PRRSV nucleic acids in type 1 PRRSV-challenged pigs but did not reduce lung lesions and type 2 PRRSV nucleic acids in type 2 PRRSV-challenged pigs. There were no significant differences between two commercial type 1 PRRSV vaccines against type 1 and type 2 PRRSV challenge based on virological results, immunological responses, and pathological outcomes. This study demonstrates that vaccinating pigs with the type 1 PRRSV vaccine provides partial protection against respiratory disease with heterologous type 1 PRRSV challenge but no protection with heterologous type 2 PRRSV challenge. P orcine reproductive and respiratory syndrome (PRRS), caused by PRRS virus (PRRSV), is one of the most economically devastating diseases facing pig production worldwide. The infection of growing pigs with PRRSV causes severe respiratory diseases, leading to impaired growth in postweaned and growing pigs (1). The virus can also give rise to reproductive failure in sows (1). PRRSV is a small, positive-sense, enveloped, single-stranded RNA virus belonging to the family Arteriviridae in the order Nidovirales (2). PRRSV is classified into type 1 (European) and type 2 (North American) genotypes based on the 3=-terminal structural genes or the entire genome (3, 4). Type 1 PRRSV is further divided into three subtypes: a pan-European subtype 1 and East European subtypes 2 and 3, with nucleocapsid protein sizes of 128, 125, and 124 amino acids, respectively (5).In South Korea, type 2 PRRSV was first isolated in 1994 (6). Until 2005, only type 2 PRRSV was detected in Korean swine herds (7,8 Since the first introduction of type 1 PRRSV vaccines, crossprotection is a major clinical issue because of the coexistence of the type 1 and type 2 PRRSVs in swine herds. Previous crossprotection studies have provided inconsistent results (11, 12). The Porcilis PRRS vaccine (MSD Animal Health) provides no protection against heterologous type 2 PRRSV challenge (11), whereas the Amervac PRRS vaccine (Hipra) provides partial protection against heterologous type 2 PRRSV challenge (12). However, a comparison of two commercial type 1 PRRSV-based modified live vaccines a...

Efficacy and safety of simultaneous vaccination with two modified live virus vaccines against porcine reproductive and respiratory syndrome virus types 1 and 2 in pigs

“…Some studies have found similar incomplete effect of vaccination following challenge of PRRSV-1 vaccinated pigs with heterologous PRRSV-1 strains [17,26], while others have found significant reduction in viremia following PRRSV-1 vaccination in a quasi-natural experimental model [27] and clinical protection in the field despite the field strain was only 85% identical to the vaccine strain in ORF 5 [19]. In the present study, vaccination against PRRSV-1 did not protect against challenge with Type 2 virus which are in accordance with the majority of previous studies [26,[28][29][30]. The challenge in the present study was performed approximately two months after vaccination which is later than in most vaccine trials.…”

Comparison of commercial type 1 and type 2 PRRSV vaccines against heterologous dual challenge

“…The latter studies investigated cross-protection of PRRSV vaccine (Park and others 2014a, 2015, Kim and others 2015). Pigs immunised with type 1 PRRSV vaccine had reduced levels of type 1 PRRSV viraemia when challenged with the same type 1 PRRSV but showed no effect on the levels of type 2 PRRSV viraemia when challenged with the same type 2 PRRSV (Kim and others 2015). In contrast, pigs immunised with the same type 2 PRRSV vaccine exhibited reduced levels of type 1 and type 2 PRRSV viraemia when challenged with the same type 1 and type 2 PRRSV (Park and others 2014a, 2015).…”

“…Real-time PCR for the vaccine virus was also performed to quantify PRRSV genomic cDNA copy (Park and others 2014a, Kim and others 2015). …”

A modified-live porcine reproductive and respiratory syndrome virus (PRRSV)-1 vaccine protects late-term pregnancy gilts against heterologous PRRSV-1 but not PRRSV-2 challenge

“…For PRRSV‐2, the forward and reverse primers were 5′‐TGGCCAGTCAGTCAATCAAC‐3′ and 5′‐AATCGATTGCAAGCAGAGGGAA‐3′, respectively (Wasilk et al., ). For UNISTRAIN vaccine virus, the forward and reverse primers were 5′‐ GTTGCCCAGCCATTTTGAC‐3′ and 5′‐CACGCTGCTGAGTACATACC‐3′, respectively (Kim et al., ). RT‐PCR for PRRSV was used to quantify PRRSV genomic cDNA copy numbers using RNA extracted from serum samples as previously described (Park, Seo, Han, Kang, & Chae, ; Wasilk et al., ).…”

“…This PRRSV‐1 MLV vaccine can protect against both PRRSV types based on the manufacturer's claims (http://www.hipra.com). However, this claim has been somewhat controversial as experimental data about cross‐protection of this PRRSV‐1 MLV vaccine against respiratory disease caused by PRRSV‐2 in growing pigs do not support this claim (Kim et al., ). Furthermore, vaccine efficacy against PRRSV‐1‐ or PRRSV‐2‐caused reproductive failure in gilts or sows has not yet been tested.…”