Comparison of molecular and cellular events during lower jaw regeneration of newt (<i>Cynops pyrrhogaster</i>) and West African clawed frog (<i>Xenopus tropicalis</i>)

Kurosaka, Hiroshi; Takano‐Yamamoto, Teruko; Yamashiro, Takashi; Agata, Kiyokazu

doi:10.1002/dvdy.21419

Cited by 32 publications

(39 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The sets of synthetic primers used for the amplification are described below: mouse glyceraldehyde‐3‐phosphate dehydrogenase gene ( gapdh ), sense 5′‐GTCCCGTAGACAAAATGGTG‐3′ and antisense 5′‐CAATGAAGGGGTCGTTGATG‐3′; mouse ameloblastin , sense 5′‐GGACCAATGGCACACAACAAAG‐3′ and antisense 5′‐AGTCTCCTAAGGGTTTGCCTG‐3′; mouse amelogenin , antisense 5′‐GCCTCCACTGTTCTCCATGC‐3′, sense 5′‐ATGTTAAGCGGATGCCTTGTC‐3′. Each PCR was carried out and analyzed as described previously [33, 34].…”

Section: Methodsmentioning

confidence: 99%

Core Binding Factor Beta Functions in the Maintenance of Stem Cells and Orchestrates Continuous Proliferation and Differentiation in Mouse Incisors

et al. 2011

Self Cite

View full text Add to dashboard Cite

Rodent incisors grow continuously throughout life, and epithelial progenitor cells are supplied from stem cells in the cervical loop. We report that epithelial Runx genes are involved in the maintenance of epithelial stem cells and their subsequent continuous differentiation and therefore growth of the incisors. Core binding factor b (Cbfb) acts as a binding partner for all Runx proteins, and targeted inactivation of this molecule abrogates the activity of all Runx complexes. Mice deficient in epithelial Cbfb produce short incisors and display marked underdevelopment of the cervical loop and suppressed epithelial Fgf9 expression and mesenchymal Fgf3 and Fgf10 expression in the cervical loop. In culture, FGF9 protein rescues these phenotypes. These findings indicate that epithelial Runx functions to maintain epithelial stem cells and that Fgf9 may be a target gene of Runx signaling. Cbfb mutants also lack enamel formation and display downregulated Shh mRNA expression in cells differentiating into ameloblasts. Furthermore, Fgf9 deficiency results in a proximal shift of the Shh expressing cell population and ectopic FGF9 protein suppresses Shh expression. These findings indicate that Shh as well as Fgf9 expression is maintained by Runx/Cbfb but that Fgf9 antagonizes Shh expression. The present results provide the first genetic evidence that Runx/Cbfb genes function in the maintenance of stem cells in developing incisors by activating Fgf signaling loops between the epithelium and mesenchyme. In addition, Runx genes also orchestrate continuous proliferation and differentiation by maintaining the expression of Fgf9 and Shh mRNA.

show abstract

Section: Methodsmentioning

confidence: 99%

Core Binding Factor Beta Functions in the Maintenance of Stem Cells and Orchestrates Continuous Proliferation and Differentiation in Mouse Incisors

et al. 2011

Self Cite

View full text Add to dashboard Cite

show abstract

“…Urodele amphibians, such as newts in the genera Cynops and Triturus, have a tremendous ability to regenerate a wide range of body parts: limbs [18], lower jaw [19], portions of the heart [20], ocular tissues including the retina [21,22], tail and central nervous system tissues, including spinal cord [23]. In newts and salamanders, regeneration of ocular tissues has been known for over a century (reviewed by [2]).…”

Section: Regeneration In Amphibiansmentioning

confidence: 99%

Turning Müller Glia into Neural Progenitors in the Retina

Fischer

Bongini

2010

Mol Neurobiol

View full text Add to dashboard Cite

Stimulating neuronal regeneration is a potential strategy to treat sight-threatening diseases of the retina. In some classes of vertebrates, retinal regeneration occurs spontaneously to effectively replace neurons lost to acute damage in order to restore visual function. There are different mechanisms and cellular sources of retinal regeneration in different species, include the retinal pigmented epithelium, progenitors seeded across the retina, and the Müller glia. This review briefly summarizes the different mechanisms of retinal regeneration in frogs, fish, chicks, and rodents. The bulk of this review summarizes and discusses recent findings regarding regeneration from Müller glia-derived progenitors, with emphasis on findings in the chick retina. The Müller glia are a promising source of regeneration-supporting cells that are intrinsic to the retina and significant evidence indicated these glias can be stimulated to produce neurons in different classes of vertebrates. The key to harnessing the neurogenic potential of Müller glia is to identify the secreted factors, signaling pathways, and transcription factors that enable de-differentiation, proliferation, and neurogenesis. We review findings regarding the roles of mitogen-activated protein kinase and notch signaling in the proliferation and generation of Müller glia-derived retinal progenitors.

show abstract

“…Kurosaka et al 80 have compared the regeneration of the Xenopus tropicalis mandible with that of the newt. BrdU labeling showed that cells of both species entered the cell cycle within a few days after amputation.…”

Section: Discussionmentioning

confidence: 99%

“…75,[77][78][79][80] Jaw regeneration takes longer than limb regeneration, about 24 weeks compared to only 4-6 weeks for the limb. Only the tooth bearing skeletal element, the dentary of the maxilla and mandible, is ossified 5 months after amputation.…”

Section: Radiograms Of Control (A B A' and B') And Ra-treated (Cmentioning

confidence: 99%