Comparison of immunoassay and real-time PCR methods for the detection of Jembrana disease virus infection in Bali cattle

Abstract

1A sensitive diagnostic assay for the detection of infections with the bovine 2 lentivirus Jembrana disease virus (JDV) is required in Indonesia to control the 3 spread of Jembrana disease. Immunoassays are used routinely but are 4 compromised by cross-reactive epitopes in the capsid (CA) protein of JDV 5 and the genetically related bovine immunodeficiency virus (BIV). JDV gag-6 specific primers were tested in a real-time PCR assay to detect proviral DNA 7 in peripheral blood mononuclear cells from 165 cattle from the Tabanan 8 district of Bali. JDV-specific amplicons were detected in 9% of the cattle and 9 only 33% of the real-time PCR positive cattle were also seropositive. The 10 delayed seroconversion that occurs after infection with JDV could explain the 11 low concordance between these assays but other factors may be responsible.

Immunodiagnosis in Jembrana Disease: A Review

“…Differentiating BIV infections is feasibly attained by the use of a specific monoclonal antibody, only recognizing BIV capside protein epitope that is absent in JDV (Zheng et al, 2001;Lu et al, 2002). Though relatively insensitive, ELISA provides an economical and feasible method for monitoring the virus in the absence of more sensitive methods (Barboni et al, 2001;Lewis et al, 2009).…”

“…JDV antigen detection using ELISA was found to be more sensitive than Western blot (Barboni et al, 2001;Lewis et al, 2009). In addition, latest achievement method in immunodiagnosis is gain by JDVp26 capture ELISA that facilitated monitoring and detection of circulating viral antigen during the acute phase of the disease.…”

“…However, molecular detection method is not always applicable as it requires a high technical skill and expensive equipments.Several viral genome amplification tools have been developed for the identification of JDV, such as in situ dot-blot hybridization (Chadwick et al, 1998), polymerase chain reaction and loop-mediated isothermal amplification which was the more recently developed and was the more sensitive (Kusumawati et al, 2015). Nevertheless, finding from a comparative study (immunological vs molecular detection methods) recommended that a combination of molecular detection and immunodiagnosis method is used for routine control of Jembrana disease in Bali cattle (Lewis et al, 2009). …”

Monitoring Proviral DNA Of Jembrana Disease Virus In Bali Cattle Using PCR

“…PCR dilakukan dalam total volume reaksi 25µl yang terdiri dari 8,5 µl Nuclease Free Water, 12,5 µl green master mix, 1 µl Forward primer (JDV 1) dengan sekuen 5'GCAGCGGAGGTGGCAATTTTGATAGG A 3', 1 µl Reverse primer (JDV 3) dengan sekuen 5' CGGCGTGGTGGTCCACCCCATG 3' (Chadwick et al, 1995) (Hartaningsih, 2002). Sel yang menjadi target infeksi dari virus penyakit Jembrana adalah sel limfosit, sehingga untuk mendeteksi keberadaan DNA provirus virus penyakit Jembrana dapat dilakukan dengan mengekstraksi DNA dari PBMC (Tenaya dkk., 2003 (Chadwick et al, 1995, Desport et al, 2007, Lewis et al, 2009. Pita DNA dengan panjang yang sama diperoleh pada kontrol positif pada penelitian ini.…”