Comparative evaluation of nucleic acid-based assays for detection of Japanese encephalitis virus in swine blood samples

Abstract

Japanese encephalitis is an emerging mosquito-borne flaviviral zoonotic disease. The present study was undertaken with the objective of developing rapid and sensitive nucleic-acid-based assays for detection of Japanese encephalitis virus (JEV) in swine blood samples. Three nucleic-acid-based assays, viz., reverse transcription polymerase chain reaction (RT-PCR), reverse transcription loop-mediated isothermal amplification (RT-LAMP), and real-time RT-PCR, were developed and compared in terms of their diagnostic efficacy. All three assays were found to be 100 per cent specific. The minimum detection limit of RT-LAMP and real-time RT-PCR was 12 copies/µl, while RT-PCR could detect 1.2 × 10(5) copies/µl. On comparison, RT-LAMP and real-time RT-PCR were 4-log more sensitive than RT-PCR. The applicability of the assays was evaluated by screening 135 field swine blood samples, of which 24 (17.77 %) were positive by RT-LAMP and real-time RT-PCR and only six (4.44 %) were positive by RT-PCR. The viral load in swine blood samples ranged between 2 × 10(6) and 4.8 × 10(9) copies per ml of blood by real-time RT-PCR. The comparative diagnostic sensitivity and specificity of RT-LAMP vis-à-vis real-time RT-PCR was found to be 100 %, while the sensitivity and specificity of RT-PCR vis-à-vis real-time RT-PCR was found to be 25 % and 100 %, respectively. Thus, the use of RT-PCR may cause the incidence of JEV in the swine population to be underestimated, while the real-time RT-PCR reported here is the test of choice for reference laboratories, and the newly developed one-step RT-LAMP assay will be suitable for field-level testing.

Challenges in Direct Detection of Flaviviruses: A Review

“…In the RT-LAMP assays to detect the YFV, it was possible to obtain an LOD of 0.29 PFU/mL [ 41 ] and 19 PFU/mL [ 42 ]. For the Japanese encephalitis virus, it was possible to obtain an LOD of 2.34 copies/µL [ 43 ], 5 pg of RNA [ 44 ], and 12 copies/µL [ 45 ]. The LOD for the West Nile virus was 0.1 PFU/mL [ 46 ].…”

Detection of Japanese Encephalitis Virus in bone marrow of healthy young wild birds collected in 1997–2000 in Central Italy

“…Real‐time PCR was carried out in a total reaction volume of 20 µl, containing 10 µl 2× SYBR Premix Ex Taq (Tli RNase H Plus; Takara, Japan), 0.4 Rox Reference Dye 50× (Takara, Japan), 10 pmol F3 forward primer (ACGAGACCGATCAATCGCT), 10 pmol B3 reverse primer (CTTTGTGGACGATCTTCGCT) and about 100 ng of cDNA. The primers amplify a 220 bp sequence of NS1 gene of JEV and have been recently designed for standardization of real‐time PCR (Dhanze et al, ). Reactions were carried out in a Step One instrument (Applied Biosystem) with the following programme: 95°C for 30 s followed by 45 cycles of PCR at 95°C for 15 s, 60°C for 30 s and 72°C for 30 s. Following amplification, a melting curve analysis (Tm) was performed to verify the authenticity of the amplified products.…”

“…The PCR mix consisted of Taq PCR Master Mix 1X (Qiagen, Germany), each of the primers F3 and B3 0.4 mM, 5 µl of cDNA and water up to 100 µl final volume. PCR was conducted as previously reported (Dhanze et al, ).…”

“…Subsequent RNA isolation steps have been performed using the (Dhanze et al, 2015). Reactions were carried out in a Step One instrument (Applied Biosystem) with the following programme: 95°C for 30 s followed by 45 cycles of PCR at 95°C for 15 s, 60°C for 30 s and 72°C for 30 s. Following amplification, a melting curve analysis (Tm) was performed to verify the authenticity of the amplified products.…”

“…Reactions were carried out in a Step One instrument (Applied Biosystem) with the following programme: 95°C for 30 s followed by 45 cycles of PCR at 95°C for 15 s, 60°C for 30 s and 72°C for 30 s. Following amplification, a melting curve analysis (Tm) was performed to verify the authenticity of the amplified products. On the basis of previous studies, a Tm of about 83.5°C was expected (Dhanze et al, 2015). As a further control, real-time PCR products were visualized by agarose gel electrophoresis.…”