Comparative evaluation of an automated ribotyping system versus pulsed-field gel electrophoresis for epidemiological typing of clinical isolates of Escherichia coli and Pseudomonas aeruginosa from patients with recurrent gram-negative bacteremia

Pfaller, Michael A.; Wendt, Constanze; Hollis, Richard J.; Wenzel, Richard P.; Fritschel, S. J.; Neubauer, Jan; Herwaldt, Loreen A.

doi:10.1016/0732-8893(96)00082-x

Cited by 98 publications

(61 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Isolates with over 85% similarity were placed in the same ERIC group. Ribotype groups were defined by the RiboPrinter system, which compares the ribopattern of each isolate to others in the database and assigns groups by differences in band number, position, and signal intensity (9). The distribution of the number of isolates within each typing group is shown in Table 1.…”

mentioning

confidence: 99%

Use of Pulsed-Field Gel Electrophoresis, Enterobacterial Repetitive Intergenic Consensus Typing, and Automated Ribotyping To Assess Genomic Variability among Strains of Nontypeable Haemophilus influenzae

et al. 2002

View full text Add to dashboard Cite

We compared 75 nontypeable (NT) Haemophilus influenzae isolates by pulsed-field gel electrophoresis (PFGE), enterobacterial repetitive intergenic consensus (ERIC)-PCR, and automated ribotyping. PFGE was the most discriminatory of the techniques. ERIC-PCR provides a useful screen but should not replace other techniques as the sole method to group NT H. influenzae strains.In distinguishing strain similarities and differences among nontypeable (NT) Haemophilus influenzae isolates, phenotypic typing methods such as outer membrane protein analysis, biotyping, and lipooligosaccharide analysis are gradually being replaced by genotypic techniques (6,8,15). Pulsed-field gel electrophoresis (PFGE) analysis compares the patterns of genomic DNA digested with a rare cutting restriction enzyme and is considered to be the "gold standard" for typing NT H. influenzae isolates. Enterobacterial repetitive intergenic consensus (ERIC) sequences are conserved regions of DNA dispersed throughout the genomes of gram-negative, enteric bacteria (7). The distribution of ERIC sequences varies between strains, and ERIC-specific primers have been used to produce genetic fingerprints of bacterial genomes (14), including NT H. influenzae strains (13). An automated technique based on traditional ribotyping has also recently been used for the epidemiologic analysis of H. influenzae strains (16).With the exception of total genome sequencing, genotypic methods are not definitive in identifying all possible strain differences. Rather, these methods group strains according to the presence of common restriction sites (PFGE and ribotyping) or the presence of PCR products of uniform size (ERIC-PCR). The choice of typing method depends on factors including time, cost, reproducibility, and the ability of a method to correctly distinguish between clonal and nonclonal isolates. In order to assess these typing techniques for studies of NT H. influenzae, we compared 75 strains by each of the three methods.Bacterial strains used in this study included H. influenzae strain Rd (1), 44 middle ear isolates, 28 nasopharyngeal or throat isolates, and 2 Brazilian purpuric fever strains. Strains were collected from sites in Minnesota (3), Ann Arbor, Michigan (11), Battle Creek, Michigan (11), and Bardstown, Kentucky (5), between 1980 and 1999. PFGE was performed on NT H. influenzae genomic DNA digested with SmaI (Gibco-BRL) as previously described (11). A 1-l aliquot of crude genomic NT H. influenzae DNA was used for ERIC-PCR in a 50-l reaction volume containing 25 pmol of ERIC1 primer (5ЈCACTTAGGGGTCCTCGAATGT A3Ј), 5mM MgCl 2 , 2 U of Platinum Taq polymerase (Gibco-BRL), and a 0.2 mM concentration of each deoxynucleoside triphosphate. PCR was initiated with a 2-min incubation at 94°C, followed by 35 cycles of 90°C for 30 s, 60°C for 1 min, and 72°C for 4.5 min. To check for reproducibility, four NT H. influenzae strains were typed using ERIC-PCR on three separate occasions. Ribotyping was performed using the RiboPrinter Microbial Characterization System from Qualico...

show abstract

mentioning

confidence: 99%

Use of Pulsed-Field Gel Electrophoresis, Enterobacterial Repetitive Intergenic Consensus Typing, and Automated Ribotyping To Assess Genomic Variability among Strains of Nontypeable Haemophilus influenzae

et al. 2002

View full text Add to dashboard Cite

show abstract

“…Both methods were reproducible. Previous work reported a 96% overall reproducibility for automated ribotyping (18). The minor differences between the two methods appear to be related to the fact that each procedure exhibits differences in resolution for different ranges of DNA fragment sizes.…”

Section: Discussionmentioning

confidence: 98%

Subtyping of Salmonella enterica Serotype Enteritidis Strains by Manual and Automated Pst I- Sph I Ribotyping

et al. 2003

View full text Add to dashboard Cite

Salmonella enterica subsp. enterica serotype Enteritidis is not readily subtyped beyond the level of phage type (PT). A recently developed method for ribotyping of this organism, which uses a mixture of PstI and SphI (PS) for restriction of DNA (PS ribotyping), has proved useful for further subtyping of a number of PTs of this organism, including PT 4. However, it has not been extensively tested with PT 8. In the present study the PS ribotyping method was used to investigate outbreaks of both S. enterica serotype Enteritidis PT 4 and PT 8 and provided subtyping data that were consistent with information obtained from epidemiologic investigations. The method proved to be more discriminatory than phage typing and pulsed-field gel electrophoresis (PFGE) combined and was useful for investigating a pseudo-outbreak involving isolates that had identical PTs and PFGE types but that could not be linked epidemiologically. Several PS ribotypes were found within the cluster of isolates indistinguishable by other subtyping methods, confirming the epidemiologic findings. Although the PS ribotyping method proved to have a superior discriminatory ability in resolving clusters, it did not have high enough throughput for use in outbreak investigations. This method has therefore been adapted for use in automated ribotyping with a RiboPrinter, and the results were compared with those obtained by manual ribotyping. Both methods produce equivalent results and are useful for obtaining epidemiologically relevant subtyping data for S. enterica serotype Enteritidis, including PT 8 strains not extensively tested previously.

show abstract

“…The ribopattern for each isolate was compared to other patterns in the Riboprinter TM database. Assignment to a particular ribogroup is based upon differences in band numbers, band position and signal intensity at a given banding position [11].…”

Section: Automated Ribotypingmentioning

confidence: 99%

Use of automated riboprinter and pulsed-field gel electrophoresis for epidemiological studies of invasive Haemophilus influenzae in Taiwan

Wang¹,

Siu

Chen

et al. 2001

Journal of Medical Microbiology

View full text Add to dashboard Cite

A total of 87 invasive isolates of Haemophilus in¯uenzae isolated throughout Taiwan from 1994 to 1998 was collected; 57 were from children <14 years old. In all, 60.9% of isolates were resistant to ampicillin and produced â-lactamase. Ribotyping revealed six different pro®les in 55 isolates of type b, nine pro®les in 10 isolates of non-type b and 12 pro®les in 22 isolates of non-typable H. in¯uenzae. Among isolates from 35 cases of meningitis, 30 (86%) were in ribogroups 1, 2 and 3 with >90% genetic similarity. Compared with all the other ribogroups, ribogroups 1, 2 and 3, which encompassed all H. in¯uenzae type b, were signi®cantly more prevalent as a cause of meningitis in children <14 years old. Further subtyping of the predominant ribogroup by pulsed-®eld gel electrophoresis (PFGE) identi®ed differences of 0±6 bands among these isolates of ribogroup 1, which indicated distant relatedness. Automated ribotyping was found to be a useful method and was less time-consuming for molecular epidemiology studies of H. in¯uenzae. PFGE is suggested as an addition to ribotyping to improve discrimination if H. in¯uenzae type b is involved. Differentiating ribogroups between type b and non-type b H. in¯uenzae by genotyping may help to understand the molecular characteristics of outbreaks, endemicity and value of vaccination. According to the results of ribotyping and PFGE, it seems possible that spread of invasive H. in¯uenzae type b had occurred and ribotyping con®rmed that there was no clonal spread of non-type b H. in¯uenzae in Taiwan.

show abstract

Comparative evaluation of an automated ribotyping system versus pulsed-field gel electrophoresis for epidemiological typing of clinical isolates of Escherichia coli and Pseudomonas aeruginosa from patients with recurrent gram-negative bacteremia

Cited by 98 publications

References 9 publications

Use of Pulsed-Field Gel Electrophoresis, Enterobacterial Repetitive Intergenic Consensus Typing, and Automated Ribotyping To Assess Genomic Variability among Strains of Nontypeable Haemophilus influenzae

Use of Pulsed-Field Gel Electrophoresis, Enterobacterial Repetitive Intergenic Consensus Typing, and Automated Ribotyping To Assess Genomic Variability among Strains of Nontypeable Haemophilus influenzae

Subtyping of Salmonella enterica Serotype Enteritidis Strains by Manual and Automated Pst I- Sph I Ribotyping

Use of automated riboprinter and pulsed-field gel electrophoresis for epidemiological studies of invasive Haemophilus influenzae in Taiwan

Contact Info

Product

Resources

About