Comparative Analysis of Multiple Sequence Alignment Tools

Mohamed, Eman M.; Mousa, Hamdy M.; Keshk, Arabi

doi:10.5815/ijitcs.2018.08.04

Cited by 5 publications

(4 citation statements)

References 21 publications

(21 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…MSA algorithms have been extensively developed, with various examples such as MUSCLE, Fast Fourier Transform (MAFFT), T-Coffee, DIALIGN, KALIGN, Clustal Omega, and probabilistic consistency-based multiple alignments (PROBCONS) [ 16 ]. Among these, MUSCLE developed by Edgar [ 17 ] reportedly has higher accuracy and lower analysis time according to Mohamed et al [ 16 ]. The quality of this algorithm is also not affected by the base length and the number of test sequences entered.…”

Section: Discussionmentioning

confidence: 99%

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Ibadurrahman,

Suryani,

Desriani

2023

Journal of Genetic Engineering and Biotechnology

View full text Add to dashboard Cite

Background The COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). Result The results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500–5,000, 6,500–7,500, and 23,300–25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. Conclusion This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

show abstract

Section: Discussionmentioning

confidence: 99%

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Ibadurrahman,

Suryani,

Desriani

2023

Journal of Genetic Engineering and Biotechnology

View full text Add to dashboard Cite

show abstract

“…Their use should be restricted to small and intermediate datasets. CLUSTAL Omega [40] and Kalign [44] are particularly fast, but less accurate [57]. They can be used to analyse datasets of up to 4,000 and 2,000 sequences, respectively [56,57].…”

Section: Plos Onementioning

confidence: 99%

“…CLUSTAL Omega [40] and Kalign [44] are particularly fast, but less accurate [57]. They can be used to analyse datasets of up to 4,000 and 2,000 sequences, respectively [56,57]. The performances of MUSCLE are intermediate [57].…”

Section: Plos Onementioning

confidence: 99%

See 1 more Smart Citation

Roadmap to the study of gene and protein phylogeny and evolution—A practical guide

et al. 2023

View full text Add to dashboard Cite

Developments in sequencing technologies and the sequencing of an ever-increasing number of genomes have revolutionised studies of biodiversity and organismal evolution. This accumulation of data has been paralleled by the creation of numerous public biological databases through which the scientific community can mine the sequences and annotations of genomes, transcriptomes, and proteomes of multiple species. However, to find the appropriate databases and bioinformatic tools for respective inquiries and aims can be challenging. Here, we present a compilation of DNA and protein databases, as well as bioinformatic tools for phylogenetic reconstruction and a wide range of studies on molecular evolution. We provide a protocol for information extraction from biological databases and simple phylogenetic reconstruction using probabilistic and distance methods, facilitating the study of biodiversity and evolution at the molecular level for the broad scientific community.

show abstract

Integrated Computer Analysis of Genomic Sequencing Data Based on ICGenomics Tool

Orlov

Bragin

Babenko

et al. 2020

Advances in Intelligent Systems and Computing

View full text Add to dashboard Cite

Comparative Analysis of Multiple Sequence Alignment Tools

Cited by 5 publications

References 21 publications

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

Roadmap to the study of gene and protein phylogeny and evolution—A practical guide

Integrated Computer Analysis of Genomic Sequencing Data Based on ICGenomics Tool

Contact Info

Product

Resources

About