Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays

Abstract

The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV.

Human cytomegalovirus genetic variability in strains isolated from Japanese children during 1983-2003

“…At first, attempts were made to amplify the a sequence gene using the primer pair described by Zaia et al [1990]; however, only 9 of the 74 (12%) strains (7 of the 48 re-isolated strains and 2 of the 26 stocked-virus fluid) could be amplified. Therefore, the forward primer was changed to our original one.…”

“…Three regions of the HCMV genome, that is, the a sequence, UL144, and gB, were analyzed using poly-merase chain reaction (PCR). Forward primer for the a sequence region was our original (TTCC CCGGGGAAT-CAAACAG), and reverse primer was described by Zaia et al [1990] (TTTTTAGCGGGGGGGTGAAA). The UL144 region was amplified using the primer pair described by Lurain et al [1999] (forward: TCGTATTA-CAAACCGCGGAGAGGAT; reverse: ACTCAGAC ACG-GTTCCGTAA).…”

“…HCMV is composed of unique long (L) and short (S) sequences containing terminal segments with repeating elements. The HCMV a sequence is located in the joining region between L and S sequences [Zaia et al, 1990;Boger et al, 2002]. Recently, the epidemiological relationships between variation of the a sequence gene and HCMV clinical isolates were reported [Zaia et al, 1990;Bale et al, 1996Bale et al, , 2001Walker et al, 2001].…”

Genetic polymorphisms among human cytomegalovirus (HCMV) wild‐type strains

“…This region has been used to establish the epidemiologic relationships among HCMV strains [77]. Phylogenetic analysis performed on 39 HCMV clinical isolates allowed the classification of their a sequences into six clades, denoted groups A, B, C, D, E, F, according to nucleotide substitutions and a sequence length [55].…”

Detection and sequence analysis of the major immediate early and PP150 gene of latent human cytomegalovirus in spleen, liver, and kidney tissues of trauma victims

“…Sequence analysis can help control an inherent problem of PCR, which is its susceptibility to artifacts caused by mispriming with genomic DNA, or with DNA from other Herpesviridae. However, PCR is a powerful tool for elucidating epidemiological patterns in the pathogenesis of HCMV [Zaia et al, 1990;Chou and Dennison, 1991;Zhang et al, 19951. Blood and/or blood products are mostly depleted of leukocytes, and therefore not a major route of HCMV transmission [Chou, 19921, but organ transplantation [Ho, 19821, especially from seropositive donors to seronegative recipients, is a potential route of infection. It therefore seems prudent not only to examine organs available for transplantation such as the liver and kidney, but also other available organs such as the spleen, for the presence of latent HCMV, employing the same techniques used for leukocyte analysis.…”