Comparative analysis of ATRX, a chromatin remodeling protein

Park, Daniel J.; Pask, Andrew J; Huynh, Kim; Renfree, Marilyn B.; Harley, Vincent R.; Graves, Jennifer A. Marshall

doi:10.1016/j.gene.2004.06.025

Cited by 16 publications

(17 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Finally, we compared the MdATRX1.1 combining sequence from M. domestica to M. eugenii ATRX sequence (Park et al 2004) and observed 90.4% identity at the nucleotide level, but only around 50% identity to M. eugenii ATRY sequence (GenBank accession number AF303445) (data not shown). We conclude, therefore, that this clone represents part of M. domestica ATRX.…”

Section: Isolation and Characterization Of The M: Domestica Atrx Homomentioning

confidence: 99%

“…Two of the six clones (DvATR2 and DvATR6) were amplified by PCR using ATRX primers, sequenced and found to be identical (GenBank accession number AY445509). Their sequence displayed 85.2% identity to exon 10 of the human ATRX gene between nucleotide 979 and 1303 and 90% identity to tammar ATRX gene (Park et al 2004), and the translated protein showed 82% similarity to the human ATRX protein. BLAST searching produced no hit to tammar ATRY (GenBank accession number AF303445).…”

Section: Isolation and Characterization Of The D Virginiana Atry Hommentioning

confidence: 99%

See 1 more Smart Citation

Molecular characterization and evolution of X and Y-borne ATRX homologues in American marsupials

et al. 2004

Self Cite

View full text Add to dashboard Cite

In eutherians, the sex-reversing ATRX gene on the X has no homologue on the Y chromosome. However, testis-specific and ubiquitously expressed X-borne genes have been identified in Australian marsupials. We studied nucleotide sequence and chromosomal location of ATRX homologues in two American marsupials, the opossums Didelphis virginiana and Monodelphis domestica. A PCR fragment of M. domestica ATRX was used to probe Southern blots and to screen male genomic libraries. Southern analysis demonstrated ATRX homologues on both X and Y in D. virginiana, and two clones were isolated which hybridized to a single position on the Y chromosome in male-derived cells but to multiple sites of the X in female cells. In M. domestica, there was a single clone that mapped to the X but not to the Y, suggesting that it represents the M. domestica ATRX. However a male-specific band was detected in Southern blots probed with the D. virginiana ATRY and with a mouse ATRX clone, which implies that the Y copy in M. domestica has diverged further from other ATRX homologues. Thus there appears to be a Y-borne copy of ATRY in American, as well as Australian marsupials, although it has diverged in sequence, as have other Y genes that are testis-specific in both eutherian and marsupial lineages.

show abstract

Section: Isolation and Characterization Of The M: Domestica Atrx Homomentioning

confidence: 99%

Section: Isolation and Characterization Of The D Virginiana Atry Hommentioning

confidence: 99%

Molecular characterization and evolution of X and Y-borne ATRX homologues in American marsupials

et al. 2004

Self Cite

View full text Add to dashboard Cite

show abstract

“…RT-PCR primers (Table 4) for cloning ATRY regions homologous to ATRX exons 18 to 29 and 28 to 35 were designed based on conserved nucleotide sequences across human, mouse and tammar wallaby ATRX (Villard et al, 1997;Picketts et al, 1998;Park et al, 2004) as part of a PCR screen. Amplified products were subjected to sequence alignment analyses including ATRX sequences and overlapping sequences from other ATRY fragments.…”

Section: Pcr-based Cloningmentioning

confidence: 99%

“…3). The highly conserved PHD-like domain of ATRX has Table 1 Gene-specific primers used to apply 3'RACE Walking to the cloning of ATRY ATRYF ATTTGTTGTGACTCTTGCCAT YSP5 GATTGCTGTATGTGACAGTGTGCT YSP6 CGTTTAAAGCAACAGAAGGTAAAGG YENDSP5 CAGAGCCTCCAGATCTAGGCA YENDSP55 CATAAATCCCTCTTGTTACCAGT YENDSP6 CCAACTGTTAGTGGTATGGAACCCCAG Table 2 Gene-specific primers used to apply 5'RACE to the cloning of ATRY been proposed to be involved in protein interactions (Gibbons et al, 1997;Park et al, 2004). ATRY maintains the core domain structural residues but there are six amino acid substitutions in the PHD-like domain at positions conserved across species in ATRX (Fig.…”

Section: Comparative Analysis Of Protein Domainsmentioning

confidence: 99%

“…Data from protein interaction, biochemical, and comparative analysis suggest that the ATRX protein interacts with protein binding partners to mediate the chromatin remodelling that accompanies transcriptional regulation and DNA replication (Bérubé et al, 2000;Xue et al, 2003;Park et al, 2004). Nuclear localization of ATRX protein is correlated with its phosphorylation status and the cell cycle stage.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation