Comparative Analysis Between Pseudomonas aeruginosa Genotypes and Severity of Symptoms in Patients with Unilateral or Bilateral Otitis Externa

Abstract

Random amplified polymorphic DNA (RAPD) analysis was done on 32 isolates of Pseudomonas aeruginosa. These isolates were obtained from 22 patients who presented to the emergency room in a major medical center in Beirut, Lebanon, during a 5-month period with the diagnosis of either unilateral or bilateral otitis externa. Patients had yellowish to greenish discharge, moderate to severe external auditory canal swelling, moderate to severe pain, and periauricular cellulitis. None of these patients had intrinsic predisposing factors. An ear swab was obtained from both ears of patients, cultured on trypticase soy agar. P. aeruginosa was identified on the basis of pyocyanine production and API identification kits. RAPD analysis was done by using two primers (10 mer and 21 mer primers) and appropriate PCR conditions on extracted DNA. Our data have shown 23 RAPD patterns (A-W) distributed among the 32 P. aeruginosa isolates. RAPD patterns were reproducible. Twenty of 32 isolates were recovered from 10 patients with bilateral otitis externa. The remaining 12 of 32 isolates were recovered from 12 different patients with unilateral otitis externa. Eleven RAPD patterns (A,B,C,D,E,F,H,I,R,U,V) were associated with severe clinical symptoms, including severe pain, severe external auditory canal swelling, periauricular cellulitis, and a yellowish discharge. The remaining RAPD patterns were not associated with severe infections. This denotes a possible association between certain genotypes and severity of symptoms.

Otite externa difusa aguda: um estudo prospectivo no verão do Rio de Janeiro

“…e, mais raramente, anaeróbios como Peptostreptococcus sp. e Bacteróides sp 8 . Segundo alguns autores, alguns genótipos de Pseudomonas sp.…”

“…Segundo alguns autores, alguns genótipos de Pseudomonas sp. podem causar otites externas mais severas do que os outros 8 .…”

“…O contato com a água favoreceria a maceração da pele do conduto e levaria à remoção do cerúmen, o que poderia favorecer a otite externa. Entretanto, outros autores afirmam que a Pseudomonas aeruginosa causadora da otite externa pode ser parte da flora normal do conduto auditivo externo, ser originada de outros pacientes ou ainda ser oriunda de diversas fontes ambientais 8 . Em nossos dados observamos alta incidência em crianças que tomam banho em piscinas caseiras , sem tratamento, e em algumas praias do Rio em particular, o que poderia, em tese, falar a favor de contaminação da água.…”

Detection of a highly prevalent and potentially virulent strain of Pseudomonas aeruginosa from nosocomial infections in a medical center

“…Random amplified polymorphic DNA (RAPD) analysis of the clinical and environmental isolates using two in-house oligonucleotide primers, Pa1 (5'AGGGGTCTTG 3') and Pa2 (5' CTTCTTCAGCTCGACGCGACG 3') was done. RAPD was carried out according to Matar et al [11] using the PTC-100™ Programmable Thermal Controller (MJ Research, Inc., Watertown, Mass., USA). Briefly, RAPD was carried out on all isolates in 100 μl reaction mixtures containing each: 10 μl of template DNA, 16 μl of dNTPs (0.2 mM), 10 μl of 10X PCR buffer (100 mM TrisHCl [pH 8.3], 500 mM KCl, 4 mM MgCl 2 ), 1 μl of primer 1 (0.5 μM), 1 μl of primer 2 (0.3 μg/ μl), 2.5 U of Taq DNA polymerase and 61.5 μl of nanopure sterile water.…”

“…The enzymatic activities of the isolates of P. aeruginosa were evaluated by spot inoculation containing 10 6 CFU/ml of the organisms in various media [12]. Media used: Brain heart infusion for the protease activity, 1% elastin (Sigma Chemical Co. St Louis, Mo.…”