Community of thermoacidophilic and arsenic resistant microorganisms isolated from a deep profile of mine heaps

Abstract

Soluble arsenic (As) in acidic feed solution may inhibit the copper (Cu) bioleaching process within mine heaps. To clarify the effect of soluble arsenic on the live biomass and bioxidative activity in heaps, toxicological assays were performed using a synthetic feed solution given by a mine company. The microorganisms had previously been isolated from two heap samples at up to 66 m depth, and cultured using specific media for chemolithotrophic acidophiles (pH 1–2) and moderate thermophiles (48°C), for arsenic tolerance assay. The four media with the highest biomass were selected to assay As-resistance; one culture (Q63h) was chosen to assay biooxidative activity, using a heap sample that contained chalcopyrite and covellite. We found that 0.5 g/L of As does not affect living biomass or biooxidative activity on Cu sulfides, but it dissolves Cu, while As precipitates as arsenic acid (H3AsO4·½H2O). The arsenic tolerant community, as identified by 16S rDNA gene sequence analysis, was composed of three main metabolic groups: chemolithotrophs (Leptospirillum, Sulfobacillus); chemolithoheterotrophs and organoheterotrophs as Acidovorax temperans, Pseudomonas alcaligenes, P. mendocina and Sphingomonas spp. Leptospirillum spp. and S.thermosulfidooxidans were the dominant taxa in the Q63–66 cultures from the deepest sample of the oldest, highest-temperature heap. The results indicated arsenic resistance in the microbial community, therefore specific primers were used to amplify ars (arsenic resistance system), aio (arsenite oxidase), or arr (arsenate respiratory reduction) genes from total sample DNA. Presence of arsB genes in S. thermosulfidooxidans in the Q63–66 cultures permits H3AsO4-As(V) detoxification and strengthens the community’s response to As.

Microbial community response to environmental changes in a technosol historically contaminated by the burning of chemical ammunitions

“…The strictly aerobic organisms belonging to the Leptospirillum genus are characterized by their high affinity with ferrous iron, which they can oxidize even at very low concentrations (Norris et al, 1987). This characteristic, associated with a high resistance to metals and As (Li et al, 2010;Casas-Flores et al, 2015), could explain the presence of organisms belonging to the Leptospirillum genus in our system. Indeed, labile amorphous Fe oxide minerals were suspected of playing an important role in the dynamics of inorganic pollutants (Thouin et al, 2016), whereas dissolved Fe concentrations remained very low in the soil interstitial water of the mesocosm (Thouin et al 2017).…”

Culture‐dependent hunt and characterization of iron‐oxidizing bacteria in Baiyin Copper Mine, China, and their application in metals extraction

“…The diversity investigation of Zijinshan commercial non‐aeration low‐grade copper extraction heap operated at 0.8 pH revealed that the 28.29% of retrieved 16S rRNA sequences were related with Leptospirillum genus even in the same site the highest 9% of the retrieved sequences were related with Leptospirillum genus . Bacterial genus of Leptospirillum had been previously isolated from the extremely low pH environments and suggested to play a predominant role in bioleaching of metals . Genus Leptospirillum commonly exists inside bioleaching tanks and ponds, mine heaps, and leaching pregnant liquor solutions .…”

Microbial contamination in methanol biofilters inoculated with a pure strain of Pichia pastoris: A potential limitation for waste revalorization

“…Biomass samples were collected from each biofilter at the different steady states of operation. The samples were frozen in liquid nitrogen and stored at −80°C for total DNA extraction as described by Casas‐Flores et al To amplify the 16S rRNA gene segments, total DNA from the extracted samples was used as template, using the universal primers 533F (5′ GTGCCAGCAGCCGCGGTAA) and 1391R (5′ CCTTAAGGTGCTGACTTTCG) . Polymerase chain reactions (PCR) were performed in a total volume of 25 μL containing 1× PCR buffer, 200 μM dNTPs, 2.5 mM MgCl 2 , 1 μM each of forward and reverse primers, and 1 U of Taq polymerase (Promega).…”