Common nucleotide sequence of structural gene encoding fibroblast growth factor 4 in eight cattle derived from three breeds

Abstract

Fibroblast growth factor 4 (FGF4) is considered as a crucial gene for the proper development of bovine embryos. However, the complete nucleotide sequences of the structural genes encoding FGF4 in identified breeds are still unknown. In the present study, direct sequencing of PCR products derived from genomic DNA samples obtained from three Japanese Black, two Japanese Shorthorn and three Holstein cattle, revealed that the nucleotide sequences of the structural gene encoding FGF4 matched completely among these eight cattle. On the other hand, differences in the nucleotide sequences, leading to substitutions, insertions or deletions of amino acid residues were detected when compared with the already reported sequence from unidentified breeds. We cannot rule out a possibility that the structural gene elucidated in the present study is widely distributed in cattle. To the best of our knowledge, this is the first determination of the complete nucleotide sequence of the structural gene encoding bovine FGF4 in identified breeds.

Production of bioactive bovine fibroblast growth factor 4 in E. coli based on the common nucleotide sequence of its structural gene in three breeds

“…The PCR product of bovine genomic DNA obtained from a Holstein cow containing the common structural gene encoding FGF4 (, Sato et al . ) was used as a template for PCR amplification of three coding exons with part of the flanking exons by adding corresponding sequences to the primers (underlined in following primer sequences) using KOD‐plus DNA polymerase (Toyobo, Osaka, Japan). Primers used were as follows: NdeIbfgf4F1 (5′‐GCAATTCCATATGCCCACCGCCCCCAACGGCACGCTGGAGGCCGAGCTGGAGCGCCGCTGGGAGAGCCTGGTGGCGCGCTCGCTGGCGCGCCTGCCG‐3′) or NcoIbfgf4F1 (5′‐CATGCCATGGGCCCCACCGCCCCCAACGGC‐3′) and bfgf4R1 (5′‐GCGCTCCACCGGCGACAGCTCCAGCAGGCTGTCACTCGTGTCCGCGTGCA‐3′) for the first coding exon, bfgf4F2 (5′‐ATCGGCGGCGTGCACGCGGACACGAGTGACAGCCTGCTGGAGCTGTCGCC‐3′) and bfgf4R2 (5′‐TCTGAACCTGCACTCGTCGGTGAAGAAAGGCGAGCCGTACAGCCTGCCCC‐3′) for the second coding exon, and bfgf4F3 (5′‐ATGAGCAGCCGGGGCAGGCTGTACGGCTCGCCTTTCTTCACCGACGAGTG‐3′) and EcoRIbfgf4R3 (5′‐CGGAATTCTCACAGCCTGGGGAGGAAGT‐3′) for the third coding exon.…”

“…Accordingly, we recently determined the FGF4 gene sequence in eight cattle derived from three breeds and revealed a common nucleotide sequence of the structural gene encoding FGF4 (, Sato et al . ), which leads to one deletion and one mutation between serine 54 (Ser 54 ) and arginine 57 (Arg 57 ) in FGF4 protein compared with . Thereafter, the coding sequence for the bovine FGF4 gene has been changed from to that clarified by us as a representational sequence (NM_001040605) in the GenBank database.…”

Generation of aminoterminally truncated, stable types of bioactive bovine and porcine fibroblast growth factor 4 in Escherichia coli

“…AB633206) and pigs (AB745732) [14,15]. The amino acid sequences of mature types of bovine and porcine FGF4 proteins comprised of 206 amino acid residues display 96% homology.…”

Common Amino Acid Sequences Deduced from Coding Exons of the PorcineFGF4Gene in Two Breeds and Production of the Encoded Protein inEscherichia coli

“…Genomic DNA was prepared from blood samples collected with heparin from two Landrace pigs, half-sisters, and three Duroc pigs, full blood, as reported previously. 12) A genomic DNA region containing the complete coding exons for porcine FGF4 was amplified by PCR as follows: PCR amplifications were performed in a 20-mL reaction volume with 200 ng of genomic DNA as template, KOD-plus DNA polymerase (Toyobo, Osaka, Japan), and a primer set (5 0 -GGCCACTGAAAGAGAGGTGGAGAAGG-3 0 and 5 0 -CAATAA-CTTTGCCCGATGATGAATGTCAAG-3 0 ), in the presence of 10% dimethyl sulfoxide and 1 M betaine. PCR was performed as follows: hot start 4 min at 98 C, followed by 50 cycles of 30 s at 98 C, 30 s at 58 C, and 5 min at 68 C, and a final extension of 5 min at 68 C. The y To whom correspondence should be addressed.…”

“…We obtained PCR products containing the complete coding exons of the bovine FGF4 gene in a previous study. 12) Hence the DNA fragment encoding bovine FGF4 (Pro 32 -Leu 206 ) was used as template for the generation of a DNA fragment encoding porcine FGF4 (Pro 32 -Leu 206 ) by site-directed mutagenesis, as follows: Gly37Arg, Arg144Lys, Pro149Ala, Thr152Ser, Arg156Lys, Arg158Lys, Asp172Tyr, and His174Tyr, the letters after the numbers indicating the amino acid residues in porcine FGF4. In order to generate pET28/ HispFGF4, the DNA fragment encoding porcine FGF4 (Pro 32 -Leu 206 ) was inserted into the NdeI/EcoRI sites of pET-28a(þ) (Novagen, Madison, WI) for efficient initiation of translation from a tag containing 6Â His (Met-Gly-Ser-Ser-His-His-His-His-His-His-SerSer-Gly-Leu-Val-Pro-Arg-Gly-Ser-His-Met) placed in the expression vector.…”