Combinational effects of muscarinic receptor inhibition and β3‐adrenoceptor stimulation on neurogenic bladder dysfunction in rats with spinal cord injury

Abstract

The combination therapy of an anticholinergic agent and a β3-adrenoceptor agonist elevated the bladder elastin level, reduced NVCs, and increased bladder compliance more effectively than the monotherapy in SCI rats. Thus, the combination therapy could be effective for the treatment of neurogenic bladder dysfunction including bladder remodeling. Neurourol. Urodynam. 36:1039-1045, 2017. © 2016 Wiley Periodicals, Inc.

Long‐term persistence with mirabegron in a real‐world clinical setting

“…13 Other factors associated with better persistence with mirabegron were female patients, older aged patients or polypharmacy according to the previous studies. [21][22][23] Thus, better efficacy of combination therapy could result in a better persistence rate with mirabegron. Furthermore, the greater efficacy of combination therapy with mirabegron and antimuscarinics for OAB patients has already been reported.…”

Effect of TRPV4 activation in a rat model of detrusor underactivity induced by bilateral pelvic nerve crush injury

“…Gene expression of TRPV4 was quantified with an MX3000P real‐time PCR system (Stratagene, La Jolla, CA) in a 25 µL volume using SYBR Green PCR Master Mix9 (QIAGEN, Valencia, CA). Reactions were polymerase activation 95°C/15 min, denaturation by cycling 40 times at 94°C/15 s, annealing 55°C/30 s, and extension 72°C/30 s. Primers used were as follows: for TRPV4 forward 5′‐ACTGGCAAGATCGGGGTCTT‐3′ and reverse 5′‐GAGGAGAGGTCGTAGAGAGAAGAAT‐3′; and for GAPDH, forward 5′‐ACTCTACCCACGGCAAGTTCAACGG‐3′ and reverse 5′‐AGGGGCGGAGATGATGACCC‐3′. The ratio of each marker to GAPDH mRNA was used for statistical analyses.…”

Injecting RNA interference lentiviruses targeting the muscarinic 3 receptor gene into the bladder wall inhibits neurogenic detrusor overactivity in rats with spinal cord injury

“…What's more, previous studies have suggested that intravesical administration of a non‐selective muscarinic receptor antagonist alone cannot affect bladder activity or cystometric parameters . In addition, cystometric parameters except time to first NVC were also not changed if oxybutynin chloride (a nonselective muscarinic receptor antagonist) was administered by oral gavage . Not surprisingly, neither M 2 ‐selective nor M 3 ‐selective antagonists administered intravesically could affect cystometric parameters .…”

“…As the mainstream treatment for overactive bladder (OAB) symptoms, antimuscarinic agents have been extensively studied in the area of neurogenic bladder dysfunction and been established as the first‐line treatment for NDO . However, due to the side effects and progressive loss of drug efficiency, patient compliance was notoriously low .…”