Collagen assembly and turnover imaged with a CRISPR-Cas9 engineered Dendra2 tag

Abstract

Electron microscopy has been the "gold standard" for studying collagen networks but dynamic information on how cells synthesise the networks has been lacking. Live imaging methods have been unable to distinguish newly-synthesised fibrils from pre-existing fibrils and intracellular collagen. Here, we tagged endogenous collagen-I using CRISPR-Cas9 with photoswitchable Dendra2 and demonstrate live cells synthesising, migrating on, and interacting with, collagen fibrils. This strategy is applicable for other long half-life proteins.There are 28 genetically distinct collagens in vertebrates of which the most abundant is collagen-I 1 .This collagen occurs as centimetre-long fibrils in the extracellular matrix and binds integrins 2 , making it essential for metazoan development 3 . The importance of the fibrils is exemplified in genetic diseases of collagen-I, for example the brittle bone disease osteogenesis imperfecta 4 , and in fibroproliferative diseases, often involving TGF-b1 stimulated collagen synthesis 5 , in which excess or ectopic deposition causes organ failure, often with fatal consequences 6 . Although the fibrils are relatively long (>1 cm) their narrow diameters (typically 50 -100 nm) limit the information that can be obtained by light and fluorescence microscopy methods. Therefore electron microscopy (predominately transmission EM and serial block face-scanning EM) has become the gold standard for studying collagen transport and fibril assembly (for example, see 7 ). However, the major setbacks are the lack of dynamic data and the inability to distinguish fibrils that are newly deposited from those that are pre-existing and might be undergoing turnover.Photoactivatable fluorescent proteins are capable of undergoing changes in fluorescent emissions in response to specific wavelengths of light irradiation. One such protein is Dendra2, which is a monomeric green-to-red photoconvertible fluorescent protein 8 that has gained popularity in studying intracellular protein movements, aggregation and turnover (e.g. see [8][9][10][11] ) but has not previously been

ER-to-Golgi trafficking of procollagen in the absence of large carriers

“…Furthermore, atypical retention of the N-propeptide due to impaired cleavage can lead to 280 A B pathologies that overlap with those of osteogenesis imperfecta and Ehlers-Danlos Syndrome (Cabral et al, 2005;Malfait et al, 2013). Another recent development has been the engineering of a photoactivatable Dendra2 fluorescent protein into the endogenous locus of COL1A2 (Pickard et al, 2018). Here, Dendra2 was placed after the N-terminal cleavage site such that it is also retain in extracellular collagen fibrils.…”

Dynamic High-Sensitivity Quantitation of Procollagen-I by Endogenous CRISPR-Cas9 NanoLuciferase Tagging

“…The NanoLuciferase sequence was taken from the pNL1.1 vector map (Promega Corporation, Madison, WI, USA); this and the sfGFP11 sequence [15] were synthesised as a gBLOCK from Integrated DNA Technologies (IDT, Coralville, USA) ( Table S2). The 5 and 3 homology arms were generated by PCR amplification using a repair template previously used to introduce a Dendra2 tag into the Col1a2 locus [17] using primers in Table S1. The NanoLuciferase gBLOCK and homology arms were joined using Gibson assembly master mix (NEB) and transformed into Stbl3 bacteria, resulting in the generation of an sfGFP11-NLuc Col1a2 repair template (Table S2).…”

“…First, 1 µg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega Corporation, Madison, WI, USA). After overnight transfection, cells were grown in fresh medium for 6 h, and then transfected with a Col1a2 crRNA (ACTTACATTGGCATGTTGCT AGG), tracrRNA and Cas9 (IDT), as previously described [17]. crRNA sequences were selected using the Wellcome Trust Sanger Institute Genome Editing database [18].…”

Dynamic protein quantitation (DyProQ) of procollagen-I by CRISPR-Cas9 NanoLuciferase tagging

“…The NanoLuciferase sequence was taken from pNL1.1 vector map (Promega) this and the sfGFP11 sequence 48 were synthesised as a gBLOCK from IDT (Supplementary Table 2). The 5’ and 3’ homology arms were generated by PCR amplification using a repair template previously used to introduce a Dendra2 tag into the Col1a2 locus 50 using primers in supplementary table 1. The NanoLuciferase gBLOCK and homology arms were joined using Gibson assembly master mix (NEB) and transformed into Stbl3 bacteria.…”

“…NIH3T3-ERsfGFP1-10 were used to perform CRISPR editing, 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours, cells were then transfected with a Col1a2 crRNA (ACTTACATTGGCATGTTGCT AGG), tracrRNA and Cas9 (IDT), as previously described 50 . After overnight transection cells were grown for 72 hours in fresh medium.…”